Labshake search
Citations for Millipore Sigma :
3851 - 3900 of 4532 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... and the plasmid encoding lentiviral genome with PGK-puroR (pLKO.1) alone or additionally with CMV-TurboGFP (SHC003, Sigma). Virus containing media was collected on days 2 and 3 after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... and a mouth pipette were used to inject into the caudal neural tube the electroporation mix (1 µg/µl each plasmid in injection solution: high viscosity carboxymethylcellulose 0.33% (Sigma); Fast Green 1% (Sigma) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Embryos were injected unilaterally with 700 nl of DNA plasmid solution (diluted in endofree PBS buffer and 0.002% Fast Green FCF (Sigma)) into the lateral ventricle ...
-
bioRxiv - Biochemistry 2020Quote: ... The WT and mutant plasmids were then transformed into Escherichia coli Rosetta™ 2(DE3)pLysS competent cells (Novagen) for protein expression.
-
bioRxiv - Biochemistry 2020Quote: ... plasmids encoding SAE1 (ampicillin resistant) and SAE2 (streptomycin resistant) were co-transformed into Rosetta (DE3) bacteria (Novagen-chloramphenicol resistant), grown to OD600 ∼0.7 ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA sequence: 5’-ACTTGGCCAAGGAGTACGG-3’) in line with GFP from the (p04) U6-gRNA:CMV-eCas9-2a-tGFP plasmid (Sigma). One day later ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by digestion and ligation of the amplification products into the NdeI and SacI sites in plasmid pET28a (Novagen). The oligonucleotides employed were the following (the TEV protease cleavage sites are underlined):
-
bioRxiv - Synthetic Biology 2021Quote: ... Ll.LtrB intron and LtrA protein was amplified from the commercial plasmid pACD4K-C (TargeTron gene knockout system, Sigma-Aldrich) with primers pGIIintron_fwd and rev (Supplementary Table S1) ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid uptake was selected for by adding fresh 2.5 nM WR99210 (Jacobus Pharmaceutical) or 5 µg/ml blasticidin (Sigma) for 5 days ...
-
bioRxiv - Microbiology 2021Quote: Plasmid DNA was transfected using either calcium phosphate transfection or Polyethylenimine (PEI, 1 mg/ml in H2O, Sigma-Aldrich) according to the manufacturers recommendations or as described previously31.
-
bioRxiv - Cancer Biology 2019Quote: The CRISPR plasmid U6gRNA-Cas9-2A-GFP containing a guide RNA targeting murine Cdc42ep5 was purchased from Sigma (MM0000377239). Parental 690.cl2 cells were transfected with that plasmid using Lipofectamine (Life Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA-calcium phosphate transfection complex was prepared by gently adding plasmid DNA and 2M CaCl2 (Sigma-Aldrich; Merck KGaA) dropwise to HBS buffer (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... MD2G (3 μg) and pLKO-LV-gene-specific (6 μg) plasmids in the presence of PEI transfection reagent (Sigma). The generated lentiviral particles were collected 24 hours post-transfection ...
-
bioRxiv - Biophysics 2020Quote: The GYMC52_3505 and pMHTDelta238 plasmids were transformed to Rosetta2(DE3)pLysS competent cells (Cat. No. 71401-3, EMD Millipore). Transformation reactions were spread on LB plates with ampicillin (Amp ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmids were incorporated into pcDNA3.1(+) vectors and were transiently transfected into HEK 293T cells using PEI (Milipore Sigma) as previously described 32 ...
-
bioRxiv - Cell Biology 2022Quote: The pEGFP-NONO_WT or pEGFP-NONO_ΔRRM1 plasmid was transformed into competent Rosetta 2(DE3)pLysS Escherichia coli cells (Novagen, 71400) and plated on LB agar plates with selection for kanamycin and chloramphenicol ...
-
bioRxiv - Cancer Biology 2022Quote: ... The clones harboring plasmids were grown in 40mL of Luria Broth (LB) culture media containing 75µg/mL Ampicillin (Sigma) overnight at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: DNA fragments were released by restriction from existing plasmids or amplified by PCR using primers synthesized by Sigma-Aldrich or Eurofins ...
-
bioRxiv - Microbiology 2021Quote: ... then selection for parasites with genomic integration of the pSLI plasmid was performed with 400 μg.mL−1 of G418 (Sigma). Recombinant parasites were checked for correct rearrangement by PCR (Supp Table 3).
-
bioRxiv - Microbiology 2021Quote: All the oligos for generation/sequencing of the plasmids used in this study were custom synthesized by Sigma Aldrich.
-
bioRxiv - Cell Biology 2022Quote: ... 5 μg of plasmid DNA was transfected per plate by incubating the DNA with 10 μg polyethyleneimine (Sigma, 408727) in serum free media for 10 min before being added dropwise to cells that had been changed to serum free media 1 hour prior.
-
bioRxiv - Biochemistry 2020Quote: ... RF cloning was also used to introduce the pseudo-wild-type SOD1 gene into the pRFSDuet-1 plasmid (Novagen). The mutant SOD1 genes were amplified with primers containing restriction sites for NdeI and AgeI and then inserted into the pRFSDuet-1 plasmid using the In-Fusion® HD cloning kit after digesting the plasmid with the same enzymes ...
-
bioRxiv - Biochemistry 2019Quote: ... A synthetic gene encoding the KRAB domain (residues 1-71) from ZNF93 (UniProt: P35789) codon-optimized for E.coli was expressed from the pET20 plasmid (Novagen) with N-terminal Twin-StrepII and maltose binding protein (MBP ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli genes for proteins bS6 and bL9 were PCR-amplified and cloned individually into the pET28(a) plasmid (Novagen). Recombinant single-cysteine proteins were then expressed ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RAMP1 expression achieved through transduction of virus containing RAMP1 MISSION TRC3 Open Reading Frame (ORF) plasmid (pLX_304) (Sigma, US) into RAMP2 KO-HUVECs ...
-
bioRxiv - Microbiology 2019Quote: Oligonucleotides used for the construction of plasmid pBBR1-Ptet-mCherry::mamK-likePoly30 were purchased from Sigma-Aldrich (Steinheim, Germany). The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific ...
-
bioRxiv - Biophysics 2020Quote: The plasmids (EX-T0572-B09, EX-D0356-B09) were transformed in RosettaTM competent cells (EMD Millipore, Burlington, MA, USA) for expression of the light chains ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Template plasmid was digested using DpnI and the PCR products were purified using a PCR purification kit (Sigma-Aldrich). Subsequently ...
-
bioRxiv - Developmental Biology 2019Quote: ... Plasmid DNA was purified with a NucleoBond Xtra Midi kit (Cultech, 22740410.50) and resuspended in nuclease-free water (SIGMA). Other plasmids used were pCMV-GFP expressing GFP under the CMV promoter ...
-
bioRxiv - Microbiology 2021Quote: The Env expression plasmids were used to transfect HEK-293T cells with X-tremeGENE HP DNA Transfection Reagent (Sigma) in combination with either a Tat expression plasmid pTat for Env expression and fusion assays ...
-
bioRxiv - Molecular Biology 2021Quote: The lysates of HEK-293T cells transfected with circPTPN12 plasmid were incubated with Protein-A/G agarose beads (Millipore) and antibody against Ago2 (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... and the reverse primer with in frame Flag sequence 5’GTCTCTCGAGTTACTTGTCATCGTCATCCTTGTAATCTTTCTTTCTGTTGCCTCC3’ and cloned into the pcDNA3 Plasmid (Sigma Aldrich) using the restriction sites HindIII and Xho1.
-
bioRxiv - Biochemistry 2021Quote: ... from the commercially available plasmid 2019-nCoV_N_Positive Control (IDT) and cloned by restriction digest / ligation into MCS-1 of pRSFDuet™-1 (Novagen) to give pSG220 ...
-
bioRxiv - Biophysics 2021Quote: ... The expression and BirA plasmids were mixed at a 9:1 ratio for transfection and 50 μM Biotin (Sigma) was added to the media 4 h post-transfection ...
-
bioRxiv - Neuroscience 2020Quote: Embryos injected with pT2 5UAS hSNRNP70-eGFP and HuC:Gal4 DNA plasmids together with UTP-Cy5 were mounted in 1% low melting point agarose (Sigma) in Danieau’s solution ...
-
bioRxiv - Molecular Biology 2021Quote: Wild-type or mutated pMAL-c2x-malE-L375-his10 plasmids were transformed into Escherichia coli strain BL21 (EMD Millipore) for subsequent growth in LB broth supplemented with 50 μg/ml carbenicillin and 0.2% (w/v ...
-
bioRxiv - Immunology 2020Quote: ... codon-optimized Bl-Eng2 open reading frame with an upstream enterokinase site and downstream c-Myc and 6X histidine tags was cloned into the SpeI and XhoI sites of the pET43.1b plasmid (Novagen); this forms a fusion protein with an upstream NusA tag ...
-
bioRxiv - Biophysics 2021Quote: ... Cells that contained the plasmid were selected based on their expression of a neo gene using geneticin (Sigma-Aldrich). The optimal dose of geneticin for the selection of cells was found to be 800 μg/ml based on a kill curve experiment (range of concentrations tested ...
-
bioRxiv - Molecular Biology 2022Quote: ... the gene encoding Cas7-11 was amplified by PCR and cloned into the modified pACYCDuet-1 plasmid vector (Novagen), expressing Cas7-11 with an N-terminal maltose-binding protein (MBP ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293T cells were co-transfected with lentiviral vector and packaging plasmids (pCMV-dR8.91 and pCMV-VSV-G) using X-treme GENE 9 reagent (Sigma). Culture supernatant containing viral particles was collected 36 and 72 h after transfection and concentrated by centrifugation at 3000g for 60 min at 4℃ ...
-
bioRxiv - Biophysics 2022Quote: ... transformed with the XylE WT gene and cloned in the (30 µg/ml) kanamycin-resistant pET28-a plasmid (Novagen) modified with a C-terminal 10-histidine tag ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μl plasmid vectors (2 μg) and/or siRNA oligos (0.1 nmol) containing 0.05% fast green FCF (Sigma-Aldrich) were injected into each DRG ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA plasmids were used at 2 µg/µl and mixed with 1% fast green (Sigma-Aldrich, final concentration 0.2%). Plasmids were injected into the ventricle with a pump-controlled micropipette ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then transfected with the indicated amount of the appropriate plasmid using X-tremeGENE HP reagent (Sigma Millipore) and experiments were performed 24 hours post-transfection.
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then transfected with the indicated amount of the appropriate plasmid using X-tremeGENE HP reagent (Sigma Millipore) and experiments were performed 24 hours post-transfection.
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T cells were transduced with retroviruses carrying mutant or WT genes in the pLenti6.2-ORF-mClover2-P2A-mRFP plasmid supplemented with 4 μg/ml of polybrene (EMD-Millipore). Cells were selected with 6 μg/ml of blasticidin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... and one ventricle of each embryo was injected with 0.5-1 μL of Endofree plasmid DNA solution mixed with 0.05% Fast Green (Sigma Aldrich) using pulled glass capillaries (Harvard apparatus ...
-
bioRxiv - Genetics 2024Quote: ... gcry1:BFP-3’mitfaHom plasmid was then added to the injection mix along with phenol red (Sigma-Aldrich P0290). The final concentrations injected into the embryos were ...
-
bioRxiv - Biochemistry 2023Quote: Genes encoding VanX (C78/157S mutants with and without W24R) were constructed using the pET-47b plasmid vector (Novagen). The HRV3C recognition sequence and a linker to improve the digestion efficiency were inserted between the (His)6-tag and the vanx sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... RAW264.7 cells were transfected with a CRISPR gRNA plasmid DNA (U6-gRNA:CMV-Cas-9-2A-tGFP) from Sigma-Aldrich, with a specific target sequence for moesin (5’-CCGGCTTCGGATTAACAAG-3’) ...