Labshake search
Citations for Millipore Sigma :
3801 - 3850 of 10000+ citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... EDTA (4 mM) (Sigma-Aldrich), dihydronicotinamide-adenine dinucleotide phosphate (NADPH ...
-
bioRxiv - Genomics 2023Quote: ... 4-thiouridine (4SU; Sigma T4509) was added to a final concentration of 500 µM for 5 min before cells were harvested with 2ml/flask of Trizol (Invitrogen 15596026) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-methylcyclohexanol (MCH, Sigma, 104191) and 3-octanol (OCT ...
-
bioRxiv - Cell Biology 2023Quote: ... T3 hormone (4 nM, Sigma) and GW7647 (PPARA agonist ...
-
bioRxiv - Cell Biology 2023Quote: ... 10−4 M mercaptoethanol (Sigma), and 10 ng/mL bFGF (R&D Systems) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4% ethanol (Sigma Aldrich) at 200 rpm for 2 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... or 4 uM A23187 (Sigma). Each experimental condition for each animal was performed in triplicate ...
-
bioRxiv - Cell Biology 2023Quote: ... T3 hormone (4 nM, Sigma) and GW7647 (PPARA agonist ...
-
bioRxiv - Developmental Biology 2023Quote: ... fixed with 4% paraformaldehyde (Sigma) for 60 min ...
-
bioRxiv - Microbiology 2024Quote: ... 4 mM TCEP (646547, Sigma), 50% v/v glycerol (BP229 ...
-
bioRxiv - Biophysics 2024Quote: ... with 4% sucrose (Sigma, #S0389). Samples were then washed >3 times in PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mM MgATP (Sigma, #A9187), 0.3 mM Na2GTP (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: 4-thiouracil (4TU, Sigma 440736) was dissolved at 200 mg/ml (1560 mM ...
-
bioRxiv - Immunology 2024Quote: ... 4-Thiouracil (4tU, Sigma, #440736) was dissolved in DMSO at 200 mg ml−1 and was then diluted in corn oil at a 1:4 ratio (50 mg ml−1) ...
-
bioRxiv - Microbiology 2024Quote: ... 4 mL/L Tween60 (Sigma), and 1 mL/L Tween20 (Fischer ...
-
bioRxiv - Molecular Biology 2024Quote: 4-thiouridine (4sU, Sigma T4509) was dissolved at 40.6 mg/ml (156 mM ...
-
bioRxiv - Neuroscience 2024Quote: ... 4 mM MgATP (Sigma, #A9187), 0.3 mM Na2GTP (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... L-Proline (4 mM, Sigma).
-
bioRxiv - Cell Biology 2024Quote: ... 4 mM copper sulfate (Sigma) and 10 mM ascorbic acid (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... SC-His+3AT is minimal medium of SC-His supplemented with 3-aminotriazole (3-AT, 0.5mM, Sigma-Aldrich).
-
bioRxiv - Plant Biology 2019Quote: ... The transformants were then spotted on SD (-Trp -Leu -His) selection media containing 0.5/1mM 3-Amino-1,2,4-triazole (3-AT; Sigma, A8056). The positive interactors were then scored based on the stringency of the selection.
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3-Amino-1,2,4-triazole (3-AT) (≥95% TLC) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Z-VAD-FMK ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 3 mg RBD protein in 3 mL PBS were mixed with equal-volume Freund’s complete adjuvant (Sigma-Aldrich) for priming ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM of 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide HCl (EDC, 22980-Sigma-Aldrich, St. Louis, MO, USA) and 5 mM of N-hydroxysulfosuccinimide sodium salt (NHS ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... SM and trunSM (tissue lysates) and 14-3-3 was performed using Immobilon Western chemiluminescent HRP substrate (Millipore) and an ImageQuant LAS 500 imager (Cytiva Life Sciences) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and HRP-conjugated Anti-Rabbit IgG Secondary Antibody) and R&D Systems/Minneapolis/MN (14-3-3-Sigma polyclonal goat IgG and HRP-conjugated Anti-Goat IgG Secondary Antibody) ...
-
bioRxiv - Microbiology 2023Quote: Diflufenican (N-(2,4-difluorophenyl)-2-[3-(trifluoromethyl)phenoxy]-3-pyridinecarbox-amide) was purchased from Sigma-Aldrich (Taufkirchen, Germany). Diflufenican metabolites AE B107137 (2-[3-(Trifluoromethyl)phenoxy]nicotinic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... The staining was revealed by exposure to 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: 3 dpf larvae were anesthetized in E3 medium containing 0.16 mg/mL Tricaine (ethyl 3-aminobenzoate; Sigma-Aldrich) and caudal fin transection was performed11 30 minutes prior to imaging ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was isolated from testis tissues (3 WT versus 3 Clpp-null)) with TRI reagent (Sigma-Aldrich), and reverse transcription was done with SuperScript IV VILO Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... and filtered through a 3-kDa molecular filter (Amicon® Ultra Centrifugal Filter, 3 kDa MWCO, Millipore Sigma) at 4°C for 90 minutes to remove proteins ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2021Quote: ... and (3-Aminopropyl) triethoxysilane (Sigma-Aldrich, A3648) in a v:v:v ratio of 100:5:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cultured on 3% polyHEMA (Sigma, P3932) coated 96 well plate for 48 h in a 37 °C humidified incubator with 5% carbon dioxide.
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... 500 μM Indole-3-acetic acid (Sigma) was added 8 h after released ...
-
bioRxiv - Cell Biology 2020Quote: ... 1i-LIF (3 µM CHIR99021, Sigma-Aldrich, cat.no ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Sigma), 50mM EDTA ...
-
bioRxiv - Cell Biology 2020Quote: ... – 50 μM in DMSO (3) Tunicamycin (Sigma) – 5 μg/ml in DMSO for 6hr (4 ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Genetics 2021Quote: ... Ni-NTA resin (EMD Millipore, 70691-3) was used to remove unreacted His-tagged nanobodies and His-tagged Sortase 5M enzyme ...
-
bioRxiv - Biochemistry 2020Quote: ... or 3) Lipopolysaccharide (LPS) (Sigma-Aldrich L3024) + interferon-γ (IFNγ ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 3 mM deferoxamine from Sigma (# BP987). Next ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3-Indoleacetic acid (Auxin, Sigma-Aldrich, I2886) was dissolved in 100% ethanol and diluted 400 times in the culture medium obtaining concentrations as indicated ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3% Bovine Serum Albumin (BSA; Sigma, A2153), 0.5% Triton™X-100 (Sigma ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3 % normal donkey serum (Sigma-Aldrich D9663), and 0.3 % Triton X-100 (Sigma 93443) ...
-
bioRxiv - Developmental Biology 2020Quote: ... phosphatase inhibitor cocktail 2 and 3 (Sigma), and cOmplete EDTA-free protease inhibitor cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1% Phosphatase Inhibitor Cocktail 3 (Sigma-Aldrich) and 0.5% Phosphatase Inhibitor Cocktail 2 (Sigma-Aldrich) ...