Labshake search
Citations for Millipore Sigma :
3601 - 3650 of 10000+ citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 2 mL of acid-buffered phenol solution (pH 6, Sigma) heated to 67 °C was added to thawed samples ...
-
bioRxiv - Neuroscience 2024Quote: ... A solution of carmine red (200 μl; 6%; C1022, Sigma) suspended in 0.5% methylcellulose (M0512 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and triphenol phosphate (TPP, 115-86-6, >99%, Sigma Aldrich) because they were (1 ...
-
bioRxiv - Neuroscience 2024Quote: ... 6 mg/mL glucose and 1x penicillin/streptomycin (Sigma, #P0781) was added and plates were incubated at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: We used the dopamine toxin 6-hydroxydopamine-hydrobromide (Sigma, #162957) to ablate dopamine neurons in the hindbrain and striatum by injecting anesthetized tadpoles with ∼50 nl of OHDA or saline into target regions of each hemisphere using a Nanoject ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 treated with 10µM DMH4 (Sigma Aldrich, Cat D8696). Wildtype 2 includes 5 wild type embryos at 5 dpf and 5 wild type embryos at 3 dpf ...
-
bioRxiv - Biochemistry 2023Quote: ... 6’-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma, Cat# D9542-10mg) in PBS to stain cell nuclei ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were treated with 6 µM CHIR99021 (Sigma, Cat#: SML1046) for 2 days in LaSR basal medium consisting of advanced DMEM/F12 (Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 1 ug/mL FSL-1 (TLR2/6 agonist, Sigma Aldrich), and 1 ug/mL LPS (TLR4 agonist from E ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, 1 μg/ml, Sigma-Aldrich), washed twice with PBS and mounted with Vectashield mounting medium (Vector Laboratories) ...
-
bioRxiv - Cell Biology 2023Quote: ... A solution of 6% carmine red (300 µl, Sigma, C1022) was prepared using 0.5% methylcellulose (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6 PAR explants were placed on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows ...
-
bioRxiv - Cell Biology 2023Quote: ... TA muscles were mounted on 6% tragacanth gum (Sigma, #G1128) and frozen in isopentane (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Hep3B2.1-7 in 6-well CellBIND plates (Sigma Aldrich) for GFP assays ...
-
bioRxiv - Neuroscience 2023Quote: ... in 6-well dishes over media (1x MEM (Millipore-Sigma), 1x GLUTAMAX (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich, 10236276001, 1:1000) in 0.1 M PBS for 15 min followed by a single wash for 10 min in 0.1 M PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 6 h and 50 nM bafilomycin A1 (Millipore, # B1793) for 5 h respectively in growth medium ...
-
bioRxiv - Immunology 2023Quote: ... 1 ug/mL FSL-1 (TLR2/6 agonist, Sigma Aldrich), and 1 ug/mL LPS (TLR4 agonist from E ...
-
bioRxiv - Neuroscience 2023Quote: ... in 6-well dishes over media (1x MEM (Millipore-Sigma), 1x GLUTAMAX (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 25 uL of (His)6-tagged TEV-protease (Sigma-Aldrich) was added and the solution incubated overnight at 4°C.
-
bioRxiv - Biochemistry 2023Quote: ... acetylated α-tubulin (mAb 6-11B-1, Sigma; 1:2000), GLI2 (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... and FAM (5(6)-carboxyfluorescein) were purchased from Sigma-Aldrich. D-biotin was purchased from GoldBio ...
-
bioRxiv - Genomics 2023Quote: ... along with 6 ug/ml of polybrene (Sigma-Aldrich, H9268). The medium was replaced on day 3 to remove the polybrene ...
-
bioRxiv - Biophysics 2023Quote: ... The solution was mixed and 6 % of methacrylic anhydride (Sigma), 9 µL of Irgacure initiator (Advanced Biomatrix ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma Aldrich, D9542; 1:5000) and sections were mounted using an aqueous mounting medium ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6 mL of 25% m/m potassium hydroxide (Sigma, USA) in methanol (Sigma ...
-
bioRxiv - Physiology 2024Quote: ... or acetylated Tubulin (T7451, clone 6-11B-1; Sigma-Aldrich ) at 4° C ...
-
bioRxiv - Cell Biology 2024Quote: ... Then primary mouse monoclonal antibody 6-11B-1 (Millipore Sigma) diluted 1:50 followed by secondary rat-absorbed Alexa 568-conjugated donkey anti-mouse antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 µl of GeneJuice Transfection Reagent (Sigma, catalog no. 70967) was mixed thoroughly with 250 µl of Opti-MEM I Reduced Serum Medium (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... MDL100907 (volinanserin; Sigma-Aldrich, CAS 139290-65-6; 0.1mg/kg) and WAY100635 maleate (Tocris Biosciences ...
-
bioRxiv - Neuroscience 2024Quote: We injected 6-OHDA hydrochloride (Sigma, St. Louis, MO, USA) to unilaterally lesioned dopamine neurons (using a 10 μL NanoFil syringe [WPI ...
-
bioRxiv - Biophysics 2024Quote: ... NFL was labeled with 5(6)-carboxyfluorescein NHS ester (Sigma), while NFH or NFM were labeled with Sulfo-Cyanine5 NHS ester (Lumiprobe) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PEG-8000 was added (Sigma-Aldrich, final concentration of 6 %) and incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-Phospho-PAK4/5/6 (pSer474) (Sigma-Aldrich, SAB4503964).
-
bioRxiv - Neuroscience 2024Quote: ... rabbit Anti-Phospho-PAK4/5/6 (pSer474) (Sigma-Aldrich, SAB4503964); rabbit Anti-Phospho-14-3-3 (pSer58 ...
-
bioRxiv - Plant Biology 2024Quote: ... 6% v/v Triton X-100 (EMD Millipore #TX1568-1) added by pipetting for a final concentration of 1% TX-100 ...
-
bioRxiv - Genomics 2024Quote: ... 6) 10 seconds in 5% Eosin Y solution (Sigma 318906), 7 ...
-
bioRxiv - Plant Biology 2024Quote: ... ½ MS (Duchefa Biochemie) and 0.5 uM 6-benzyl aminopurine (Sigma), adjusted to pH5.7 using 0.5 M KOH (Sigma).
-
bioRxiv - Cell Biology 2020Quote: ... 40 mL of 3% polyvinyl alcohol (3% w/v PVA) (Sigma-Aldrich CO., St. Louis, MO, USA) were added and the mixture was mechanically stirred at 600 rpm for 4 h (RW-20 ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The rANF single strands DNAs (5’-AGAGGTCATGAAGGACATT-3’ and 5’AATGTCCTTCATGACCTCT-3’) were purchased from Sigma Aldrich and annealed ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then placed in 0.025% 3-3’-diaminobenzidine tetrahydrochloride (DAB, Sigma-Aldrich, St. Louis, MO), 0.01M Imidazole (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... P4 5’ CTTGTCGTCATCGTCTTTGTAGTCCTTGTC 3’ and P5 5’ CAGGAAACA GCTATGACCATG 3’ and KOD Hot Start DNA Polymerase (Millipore).
-
bioRxiv - Bioengineering 2020Quote: ... we added 200 μL of a freshly made 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma-Aldrich) solution 2% w/v (corresponds to 10 mg EDC in 500 μL MES buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... CEP192 knockdown was achieved by transfecting the oligo duplex: 5’-GGAAGACAUUUUCAUCUCUtt-3’ and 5’-AGAGAUGAAAAUGUCUUCCtt-3’ (Sigma).
-
bioRxiv - Biochemistry 2022Quote: ... The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma) with 312.5 pmole [γ-32P] ATP (6000 Ci/mmol ...
-
bioRxiv - Bioengineering 2020Quote: ... pH 5.8 and reacted with 600 molar excess of 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma) and 200 molar excess racemic aminomethylnicotine for 20h ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coupled with the Supelco Discovery HS F5-3 HPLC column (150 ×2.1 mm × 3 µm) (Sigma Aldrich). Mobile phase A consisted of 10 mM ammonium formate ...