Labshake search
Citations for Millipore Sigma :
3701 - 3750 of 10000+ citations for IL 3 Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... anti-Partitioning-defective 3 (Par3) (Sigma, 07-330, 1:1000), anti-Parvin (Cell signaling ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated for 3 days in JB-4 (Sigma)/Eosin (Sigma)/Acridine orange (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... DL-Serine Hydroxymate (SHX, Sigma CAS Number 55779-32-3), an inhibitor of seryl-tRNA synthetase which triggers the stringent response and prevents new rounds of replication ...
-
bioRxiv - Bioengineering 2022Quote: ... 121 mg of N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide ( EDC) (Sigma) and 28 mg of RGD peptide ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3:1 mixture of random hexamers/OligodT (Sigma-Aldrich), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μL of 1 mg/mL RNase A (Sigma R6148) and 3 μL of 20 mg/mL Proteinase K (NEB EO0491 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% murine plasma and 10 mM HEPES (Sigma) and left to settle for 45 minutes in the incubator at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Biophysics 2019Quote: ... then bound proteins were eluted with 3 mM desthiobiotin (Sigma) or 50 mM D-biotin (CHEM-IMPEX ...
-
bioRxiv - Neuroscience 2019Quote: ... the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich, Ref. #TRCN0000012392) or the shRNA control (dsRed2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Phosphatase Inhibitor Cocktail no.2 and no.3 (Sigma). Following manufactures recommendations ...
-
bioRxiv - Physiology 2019Quote: ... and 100 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich) was added to elicit a maximal cAMP response ...
-
bioRxiv - Immunology 2019Quote: ... and incubated in blocking buffer (3% BSA (#A7906, Sigma, USA) in PBS supplemented with 0.1% Triton X-100 (#9002-93-1 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 mM of HCL (Millipore Sigma, cat no. HX0603-3), and 0.5 mM of iron (II ...
-
bioRxiv - Immunology 2019Quote: The macrophages were activated by 3 μg/mL LPS (Sigma) and 100 pmol IFN-γ for 6 hrs ...
-
bioRxiv - Physiology 2020Quote: ... containing 3% (w:v) bovine serum albumin (BSA) (Sigma Aldrich, Australia), 1 mg/ml Type 2 Collagenase (Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Immunology 2019Quote: ... followed by blocking of endogenous peroxidase with 3% H2O2 (Sigma H-1009 ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 mg/L indole-3-acetic acid (Sigma-Aldrich, USA), 1 mg/L zeatin-riboside (Sigma-Aldrich ...
-
bioRxiv - Genetics 2019Quote: ... 0.1 mg/ml 3-sn-Phosphatidic acid sodium salt (Sigma) respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Genejuice (EMD Millipore) and 1 μg plasmid DNA ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 mM 5-phosphoribosyl 1-pyrophosphate (PRPP Sigma-Aldrich P8296), 2 mM ATP ...
-
bioRxiv - Genomics 2019Quote: ... and 0.25 mM (days 3-10) ascorbic acid (Sigma-Aldrich).
-
bioRxiv - Bioengineering 2019Quote: ... and (3-aminopropyl)trimethoxysilane (24 mL) (APTMS 97%, Sigma-Aldrich). The mixture was incubated in an oil bath at 40 °C with magnetic stirring at 400 rpm for 16 h ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by addition of 3 mL ethylene glycol (Sigma-Aldrich) to remove unreacted sodium periodate ...
-
bioRxiv - Immunology 2019Quote: ... After 3 minutes 200μl of 0.5% Evans Blue dye (Sigma) was injected into the tail vein ...
-
bioRxiv - Immunology 2021Quote: ... JEG-3 were pre-treated with 10 μM salubrinal (Sigma) for 1 h before infection ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated with TO-PRO-3 iodide (T3605, Sigma) for 30 min at RT ...
-
bioRxiv - Biophysics 2021Quote: ... 3-Maleimido-2,2,5,5-tetramethyl-1-pyrrolidinyloxy (M-PROXYL, Sigma Aldrich), 3-((2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)methyl)-2,2,5,5-tetraethylpyrrolidin-1-oxyl (MAG1) ...
-
bioRxiv - Bioengineering 2021Quote: ... was filled with 3 ml of Histopaque 1119 (Sigma Aldrich); then ...
-
bioRxiv - Bioengineering 2021Quote: ... and (3) neuronal nuclei (NeuN; 1/1000, chicken, Millipore, ABN91), a neuron-specific protein in nuclei ...
-
bioRxiv - Bioengineering 2021Quote: ... 20.5 µL of N-[3-(dimethylamino)propyl]methacrylamide (Sigma-Aldrich), and 309 µl of 1 mM HEPES buffer were combined and mixed by vortexing ...
-
bioRxiv - Bioengineering 2021Quote: ... After blocking with 3% bovine serum albumin (BSA, Sigma-Aldrich) for 20 min ...
-
bioRxiv - Bioengineering 2020Quote: ... and 3-Isobutyl-1-methylxanthine (IBMX) (all from Sigma-Aldrich), 10% FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... Collected elutes were concentrated to 2.5-3 ml by Millipore Amicon Ultra-15 (30,000 MWCO ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1:100 phosphatase inhibitor cocktail 3 (Sigma Aldrich, #P0044). This mixture was placed for 5-15 minutes in a bullet blender at 4°C until fully homogenized ...
-
bioRxiv - Neuroscience 2021Quote: ... and then blocked with 3% Bovine Serum Albumin (BSA, Sigma) with 0.1% Triton X-100 in DPBS for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... 3% B where solvent A = 0.1% formic acid (FA, Sigma) in water (Thermo-Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... as above and phosphatase inhibitors (Cocktails 2 and 3, Sigma). Proteins were quantified by Bradford assay (Biorad) ...
-
bioRxiv - Microbiology 2021Quote: ... Erythrocytes were supplemented with 3 units/ml heparin (Sigma-Aldrich). Parasites were grown in asexual parasite culture medium (RPMI 1640 with 25 mM HEPES (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 µg pLKO.1-shARID1A (MISSION shRNA (Sigma-Aldrich), (TRCN0000059090 or TRCN0000059089 ...
-
bioRxiv - Biophysics 2021Quote: ... that we activated with 3-(trimethoxysilyl) propyl methacrylate (Sigma-Aldrich) in ethyl alcohol (Pharmco-Aaper ...
-
bioRxiv - Cancer Biology 2020Quote: ... was acquired from MedChemExpress and XRP44X (Ras-Net-Elk-3 inhibitor) from Sigma-Aldrich. The drugs were reconstituted in DMSO ...
-
bioRxiv - Physiology 2021Quote: ... 3-isobutyl-1-methylxanthine (0.5 mM, Catalog I6879, Sigma-Aldrich), dexamethasone (1.0 μM ...
-
bioRxiv - Bioengineering 2021Quote: ... treated with 0.5% 3-Aminopropyl triethoxysilane (APTS) (Sigma Aldrich A3648) for 3 minutes then with 0.5% Glutaraldehyde (Sigma Alrich G6257 ...
-
bioRxiv - Bioengineering 2021Quote: ... for 3 minutes then with 0.5% Glutaraldehyde (Sigma Alrich G6257) for 30 minutes ...
-
bioRxiv - Biochemistry 2020Quote: Rosetta 2(DE3)pLysS (EMD Millipore Novagen, Cat. # 71403-3)