Labshake search
Citations for Millipore Sigma :
3551 - 3600 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Gene expression of endogenous CENP-C was inhibited using a single siRNA (target sequence: 5’-GGAUCAUCUCAGAAUAGAA-3’ obtained from Sigma-Aldrich), which targets the coding region of CENP-C mRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Inserts were then washed 3 times for 5 min in 0.3% TritonX (Simga; T8787) in PBS and blocked for 1 hr at RT in 5% normal donkey serum (NDS, Millipore; S30), 1% BSA 0.3% TritonX in PBS ...
-
bioRxiv - Genetics 2021Quote: ... Primary antibodies at appropriate dilutions (Supplementary Table 3) were prepared in blocking buffer with 0.1% Tween 20 (Sigma, 9005-64-5). The membrane was incubated in the primary antibody solution overnight at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 µL of cells were transferred into 100 µL of staining solution (Phosphate Buffer Saline + 3 µM propidium iodide (Sigma-Aldrich) + 200 nM YP (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... The primary antibody buffer was 3% horse serum and 5% DMSO dissolved in 1X PBS with 0.2% Tween-20 (Sigma Aldrich, P2287) and 10 μg/mL heparin (Sagent Pharmaceuticals ...
-
bioRxiv - Neuroscience 2020Quote: ... cell death caused by drugs were detected by double staining the cells with 5 μl Hoechst 33342 (23491-52-3, Biotech, China) and Propidium iodide (PI) (P4170, Sigma, USA) for 15 min at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked at room temperature with either 5% (w/v) non-fat milk or 3% (w/v) BSA (Sigma- Aldrich) in Tris-buffered saline (TBS ...
-
bioRxiv - Microbiology 2021Quote: Metabolites were extracted from cell pellets through addition of 50 μl chloroform and vigorous vortexing, followed by 200 μl methanol/ultrapure water (3:1, containing 5 μM scyllo-inositol (Sigma I8132) as internal standard ...
-
bioRxiv - Cell Biology 2021Quote: ... validated lentiviral constructs (pLKO.1) expressing Mission shRNA targeting the following region 5’-GCTAGATTTACTAATGCCA-3’ in CPAP or scrambled shRNA were purchased from Sigma-Aldrich. For generation of stable cells ...
-
bioRxiv - Molecular Biology 2022Quote: Human hPSCs cultured on MEFs were harvested using collagenase IV as big aggregates and settled 3 times in washing media (DMEM [Thermo Fisher Scientific], 5% Newborn Calf Serum [Sigma] ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell pellet was resuspended in lysis buffer (100 mM Tris, pH 7.4, 150 mM NaCl, 5 mM imidazole, 3 mM βME, and protease inhibitor cocktail from Sigma-Aldrich: P8849), lysed by sonication ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNAs immersed in Trizol were added to phase-lock heavy gel tubes (Brinkmann Instruments, INC., #955-15-404-5) and mixed with 100 uL of 1-bromo-3-chloropropane (BCP) (Sigma, #B9673), followed by room temperature incubation for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... Printed discs were incubated in 0.1 mg/mL FITC-labelled dextran molecules (size either 3-5 kDa, 10 kDa, 20 kDa or 70 kDa (Sigma-Aldrich)) dissolved in PBS with 20mM CaCl2 (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... To activate the NLRP3 inflammasome BMMs were first primed with LPS in cell culture medium or left unstimulated for 3 h before cells were treated with 5 µM nigericin (Sigma-Aldrich) for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... and after 3-5 days transplanted into pots containing autoclaved vermiculite and sterile 0.5 × Murashige and Skoog (MS) medium (Sigma Aldrich, USA) with no carbon supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... The panel of substances tested included several nucleosides/nucleotides or derivates (ATP, ADP, 5’-AMP, 3’-AMP, cyclic AMP, adenosine, GTP, TTP, inosine, sodium polyphosphate, Sigma-Aldrich), biogenic amines (epinephrine ...
-
bioRxiv - Neuroscience 2021Quote: ... Then the sections were washed 3 times with PBS for 10 min each and stained with DAPI (1:10000 of 5 mg/mL, Sigma-Aldrich). Images were acquired using a Zeiss 780 inverted confocal microscope ...
-
bioRxiv - Physiology 2021Quote: ... Samples were then immersed in 5% (v/v) H2O2 in methanol for up to 3 hours (Sigma-Aldrich Cat No: H1009) for bleaching ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-5 kDa fluorescein isothiocyanate-dextran (FITC-dextran) and 65-85 kDa tetramethylrhodamine isothiocyanate (TRITC-dextran) were obtained from Sigma-Aldrich. Transwell permeable polyester membranes (400 nm pore ...
-
bioRxiv - Biochemistry 2021Quote: ... Depletion of endogenous Spindly was achieved through reverse transfection with 50 nM Spindly siRNA (5′-GAAAGGGUCUCAAACUGAA-3′ obtained from Sigma-Aldrich) for 48 hours with RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 % CO2 at 37 °C were seeded on Seahorse microplates pre-coated with 3 μg/mL collagen I (C9791, Sigma Aldrich) in 0.1 M acetic acid and allowed to adhere for at least 12 h ...
-
bioRxiv - Cell Biology 2020Quote: ... TRCN0000073737 5’-CCGGCGCGTTATCAACTGGATCCAACTCGAGTTGGATCCAGTTGATAACGCGTTTTTG-3’ designed and cloned into the lentiviral pLKO.1 puromycin resistant vector Mission shRNA lentiviral Transduction particle (Sigma Aldrich). Control Caco2 clones (shNT ...
-
bioRxiv - Microbiology 2020Quote: ... The resin was washed 5 times and transferred to a spin column with 40 μl of 3 X Flag peptide (Sigma, #F4799) for 1 h at 4°C on a rotator ...
-
bioRxiv - Immunology 2020Quote: ... and 2.5 ng/mL TNF-α for 3-5 days and subsequent differentiation in RPMI (Sigma, St Louis, Mo; +10% FCS) either with 100 ng/mL GM-CSF ...
-
bioRxiv - Genomics 2021Quote: ... The cells were rinsed and kept in the blocking buffer before photo-bleaching and submerged in 3-5’-diaminobenzidine (DAB) solution (Sigma Aldrich) during photo-bleaching on the cold stage.
-
bioRxiv - Biochemistry 2022Quote: ... for 24 hours and serum starved with OptiMEM for 48 hours prior to fixation with 3% PFA/PBS for 3 minutes in room temperature followed by a 5 min incubation at −20 °C with pre-cooled methanol (Sigma Aldrich). Fixed cells were blocked with 3% BSA (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... (The first synthesis of 5’-Deoxy-5’-thiothymidine via the deacetylation of the 3’,5’-diacetyl analog was reported in 1964.(53)) Reagents were purchased from Sigma-Aldrich Chemical Co ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’) targeting exon 7 of ERBB2 (cloned by Twin Helix) and selected with puromycin (Sigma-Aldrich) for 4 days (1 μg/ml puromycin for 72 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked with PBS containing 0.1% (v/v) Tween-20 and either 5% (w/v) non-fat dry milk (Carnation) or 3% bovine serum albumin (BSA, Sigma-Aldrich) for phosphorylated proteins detection ...
-
bioRxiv - Cell Biology 2024Quote: C57/BL6 mice at 9 months of age that were administrated with ABT263 or control vehicles at 3 months of age were injected with 5 IU of eCG (Sigma, G4877). The ovaries were collected at 44 hours after the eCG injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... Freshly resected left ventricular tissue (~3-5 mg per sample) was pulled into fibers and permeabilized in the presence of saponin (50 μg/mL, Sigma, 47036) 30 min at 4°C in BIOPS buffer containing the following ...
-
bioRxiv - Cell Biology 2023Quote: The MISSION® pLKO.1-puro Non-Target shRNA (scr) and the shRNA against the UTR of human ZIP11 gene (5’-TCCTGATTGACTCTGATTATA-3’, Cat. TRCN0000434903) were from Sigma-Aldrich. The mammalian gene expression vector pLV[Exp]-EGFP/Neo-Ef1A (pLV ...
-
bioRxiv - Physiology 2023Quote: ... in addition to silent mutations introducing a Mlu1 restriction enzyme recognition site to facilitate genotyping (5’ccacccgtcccctgagcctg aggggctccatgctgagcgtgcttccatccccagccaTTAttTacGCGTagcgcccagcagccatccattgtgccattcaca ccccaggcctacgaggag 3’; capital letters denote the mutated bases) (Sigma Aldrich). The gRNA ...
-
bioRxiv - Microbiology 2023Quote: ... 20 mM glucose final concentration; 10 g tryptone [Fisher Bioreagents, BP1421], 5 g yeast extract [Fisher Bioreagents, BP1422], 3 g K2HPO4 [Sigma-Aldrich, P3786] ...
-
bioRxiv - Immunology 2023Quote: ... mice were orally gavaged with 150 μL of an 80 mg/mL solution of 3-5 kDa-FITC-Dextran (Sigma-Aldrich) in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Triton-X 100 in PBS with 5 min incubation between each wash and blocked using 3% bovine serum albumin (BSA, A2058, Sigma-Aldrich) in PBS for 1 hr at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... in PBS for at least 30 min at 37 °C and permeabilized with PBS containing 0.1 % Triton-X for 5 minutes and blocked with blocking solution (3 % BSA in PBS) at RT for 30 minutes (all reagents from Sigma-Aldrich). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were washed 3 times with PBS for 10 min each and stained with DAPI (1:10000 of 5 mg/mL, Sigma-Aldrich) before mounted ...
-
bioRxiv - Physiology 2023Quote: ... Gene ablation was induced starting at 3 months of age using intra-peritoneal (20 mg/kg per day for 5 days; Sigma #T5648) and then chow-mediated intake (40 mg/kg ...
-
bioRxiv - Neuroscience 2023Quote: ... a sense sequence based on 5’-GCCCTAATCCAGAATCTTGTA-3’ corresponding to nucleotides 2473-2493 of mouse mDia3 (DIAPH2; NM_172493.2; Sigma-Aldrich, Cat# TRCN0000108782) was used to construct f(U6 ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Neuroscience 2024Quote: Incubation chambers were set up to submerge slices in oxygenated (95% O2, 5% CO2) aCSF containing a selection from the following drugs: 3 µM puromycin dihydrochloride (Sigma P8833), 100 µM dopamine hydrochloride (Sigma H8502) ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 nmol of 5’/3’ diamino-modified ssLNA (IDT) was mixed 100 nmol of NHS-Alexa Fluor 568 or NHS-AlexaFluor 647 (Sigma Aldrich) in 1:1 PBS:DMSO ...
-
bioRxiv - Microbiology 2024Quote: ... 20 mM glucose final concentration; 10 g tryptone [Fisher Bioreagents BP1421], 5 g yeast extract [Fisher Bioreagents BP1422], 3 g K2HPO4 [Sigma-Aldrich P3786] ...
-
bioRxiv - Immunology 2024Quote: ... Red blood cells were then lysed by incubating for 3 min at room temperature in 5 mL of lysis buffer [0.864% ammonium chloride (Sigma-Aldrich, A0171) diluted in sterile deionized H2O] ...
-
bioRxiv - Cell Biology 2024Quote: ... After 5 h of incubation the culture medium was de-proteinized by adding an equal volume of 3% trichloroacetic acid (Sigma # T6399) and incubation at 50 °C for 30 min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 3–5 μM of the mCherry-fusion protein was incubated with 1 mg/mL bovine serum albumin (BSA) (Sigma-Aldrich, A3059) in 1×TBS-Ca2+ for 15 minutes at room temperature (Supplementary Fig ...
-
bioRxiv - Biophysics 2022Quote: ... The clean coverslips were silanized by incubating in a solution of 2% (v/v) 3-aminopropyl-triethoxysilane (Sigma-Aldrich A3648) in acetone for 30 minutes ...
-
bioRxiv - Bioengineering 2021Quote: ... 200 mg Ru(dpp)3(ClO4)2 complex was dissolved in 10ml ethanol (ACS reagent ≥99.5%, CAS 459844; Sigma-Aldrich). Silica gel was prepared by adding 2 g silica particles to 40 ml aqueous NaOH (0.01N ...