Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... +10% Human AB serum (Sigma) + 10 ng/ml IL-15 and 10 IU of IL-2 (Stemcell Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human Tensin1 (SAB4200283, Sigma), anti-human p-paxillin Y118 (Cell Signaling ...
-
bioRxiv - Developmental Biology 2022Quote: ... where human chorionic gonadotropin (Sigma) was used for ovulation according to (Sive et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human-Talin1 (T3287, Sigma), anti-a-tubulin (sc-32293 ...
-
bioRxiv - Cell Biology 2023Quote: ... 850 nM human insulin (Sigma), 500 nM 3-isobutyl-1-methylxanthine (IBMX ...
-
bioRxiv - Cell Biology 2023Quote: ... 850 nM human insulin (Sigma), 500 nM IBMX (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... +5% human AB serum (Sigma) +2 mM L-glutamine +100 units penicillin-streptomycin +25 mM HEPES buffer +1x non-essential amino acids (NEAA) ...
-
bioRxiv - Cell Biology 2023Quote: ... with 2% human serum (Sigma), then labelled with APC-conjugated anti-mouse CD31 antibody ...
-
bioRxiv - Biochemistry 2023Quote: ... Ras (human) (553325, EMD Millipore) was diluted in SEC buffer.
-
bioRxiv - Neuroscience 2023Quote: ... human nuclei (1:1000, Millipore), Islet1 (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Hemoglobin (Hb) (H7379, Sigma) was solubilized in sterile H2O at 10 mg/mL concentration ...
-
bioRxiv - Bioengineering 2023Quote: ... and Thrombin (Human plasma, Sigma). Type I collagen (Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (Sigma-Aldrich, #5051); Rhodamine-conjugated fibronectin (Cytoskeleton Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... 1% human insulin (Sigma-Aldrich), and penicillin (100 I.U./ml ...
-
bioRxiv - Immunology 2023Quote: ... A human IgG (Sigma #I2511) standard curve (ten three-fold serial dilutions starting at 20 µg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... 1% human insulin (Sigma-Aldrich), and penicillin (100 I.U./ml ...
-
bioRxiv - Immunology 2023Quote: ... 2% human serum (Sigma-Aldrich), 1% non-essential amino acids (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... human insulin (I2643-25mg, Sigma) and monothioglycerol (M1753 ...
-
bioRxiv - Immunology 2024Quote: ... A human IgG (Sigma #I2511) standard curve (10 three-fold serial dilutions starting at 20 µg/mL ...
-
bioRxiv - Molecular Biology 2021Quote: Human genomic DNA was isolated from HeLa cells using a GenElute™ Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich). Target genes were PCR amplified from genomic DNA using Phusion® High-Fidelity DNA Polymerase (NEB ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: Binding of cGAS and dsDNA in human and mouse brain sections was determined by PLA kit (DUO92101, Sigma-Aldrich) accordingly to the manufacture’s instruction ...
-
bioRxiv - Genetics 2022Quote: ... Media aliquots were frozen and subjected to ENG ELISA analysis with the Human Endoglin ELISA kit (Sigma-Aldrich RAB0171) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cytokine analysis was performed by Cincinnati Children’s Hospital Research Flow Cytometry Core per kit instructions (Milliplex MAP human protein panel, Millipore-Sigma).
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2–3 endodermal explants (2PP or 3/4PP endoderm) were combined with 2–3 mesenchymal explants on Nucleopore membrane filters (Millipore) supported by fine meshed metal grids (Goodfellows) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μM (2’Z,3’E)-6-Bromoindirubin-3’-oxime (Sigma, B1686), 20 μM Tideglusib (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC-HCl; Sigma-aldrich) were added at a concentration of 0.47 and 0.95 mg mL-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Molecular Biology 2022Quote: Cell growth was monitored by cell counting and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay using MTT cell growth assay kit (#CT02, Millipore). FL or ΔN-Drosha cells (1×105 ...
-
bioRxiv - Neuroscience 2022Quote: ... or MG132 using a MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium-based in vitro toxicology kit (TOX1-1KT, Sigma). 10 µl MTT solution was applied to cells at the end point of the experiment and incubated for 4 hours ...
-
bioRxiv - Pathology 2020Quote: ... high-purity (>99%) human CRP obtained from human plasma (C4063; Sigma-Aldrich, Saint Louis, Missouri) was infused via the femoral vein after 45 minutes of ischemia with LAD ligation ...
-
bioRxiv - Biophysics 2020Quote: ... Human Serum from human male AB plasma and NaOH 1N Bioreagent were purchased from Sigma. ss M13mp18 ...
-
bioRxiv - Immunology 2023Quote: ... Human platelets were stimulated with 1 U ml−1 Thrombin from human plasma (Sigma-Aldrich) or left unstimulated for 30 min to assess the purity and activation of isolated cells ...
-
bioRxiv - Biophysics 2019Quote: ... 3 μL benzonase (Novagen) and sonicated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μM CHIR99021 (Sigma), 1 μM PD0325901 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % donkey serum (Millipore) and 0.5 % Triton X-100 in PBS at RT for 3 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3) Progesterone (Sigma P8783) – 0.02 µg/ml final concentration ...
-
bioRxiv - Developmental Biology 2021Quote: Nutlin-3 (Sigma, N6287) was dissolved in corn oil (Sigma ...