Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Insulin solution human (Sigma Aldrich, I9278);
-
bioRxiv - Biochemistry 2024Quote: ... human Glu-Fibrinopeptide B (Sigma-Aldrich) was recorded throughout the analysis for lock-mass calibration ...
-
bioRxiv - Neuroscience 2023Quote: ... recombinant human TNFα (Sigma Aldrich, #H8916), PGE2 (Sigma Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... thrombin from human plasma (Sigma-Aldrich) and GelMA (8.7% w/v) ...
-
bioRxiv - Pathology 2024Quote: ... and 0.5mg human fibrinogen (Sigma-Aldrich) in a total volume of 100µL EHT culture media (Celo.Cardiomyocyte advanced culture media ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Immunology 2024Quote: Human Immunoglobulin G (IgG) (Millipore-Sigma) was fluorescently labeled with CFTM 568 maleimide dye (CF568 ...
-
bioRxiv - Bioengineering 2024Quote: IgG from human serum (Sigma-Aldrich) was incubated at 62°C for 30 min to induce aggregation ...
-
bioRxiv - Bioengineering 2024Quote: ... or human complement C1q (Sigma-Aldrich) were immobilized on a CM5 or C1 sensor chip (Cytiva ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 mg/mL human fibrinogen (Sigma), 10% Matrigel (Corning) ...
-
bioRxiv - Cancer Biology 2024Quote: ... raised against human ST3GAL1 (Sigma HPA040466) and ST3GAL2 (Abcam ab96028) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10nM recombinant human gastrin (Sigma; G9145), 5ng/mL recombinant human HGF (PeproTech ...
-
bioRxiv - Microbiology 2024Quote: ... 10 % human AB serum (Sigma-Aldrich), and 10 ng/ml recombinant human macrophage colony stimulating factor (Peprotech ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% human serum albumin (Sigma-Aldrich), 0.0002% heparin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Levels of nitrate and nitrite in plasma obtained from human and mice were estimated by a Griess colorimetric assay kit (Sigma chemicals) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Secretion of the following cytokines was quantified with the MILLIPLEX® Human CD8+ T Cell Magnetic Bead Panel Premixed 17 Plex - Immunology Multiplex Assay kit (EMD-Millipore): IL-6 ...
-
bioRxiv - Immunology 2023Quote: ... EasySep™ Human CD56 Positive Selection Kit II) and were frozen down in CS10 CryoStor cell cryopreservation media media (Sigma-Aldrich).
-
bioRxiv - Neuroscience 2023Quote: ... and Aβ 1-42 using the Milliplex® MAP Human Amyloid Beta and Tau Multiplex Assay kit (Millipore Sigma HNABTMAG-68K). All kits were read on a MAGPIX® system (Luminex ...
-
bioRxiv - Bioengineering 2022Quote: Human ovarian cancer A2780 and Adriamycin resistant human ovarian cancer A2780-R cells were procured from Sigma Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... and another was loaded with 10 ng of human HSP70 (His tagged human HSP70, SRP5190, Millipore Sigma), which allowed comparisons to be made among separate gels ...
-
bioRxiv - Genetics 2022Quote: ... Human Erythroleukemia (HEL) and human TF-1 cells were cultured in RPMI-1640 medium (Sigma Aldrich #R8758) supplemented with 10% Fetal Bovine Serum (Sigma Aldrich #F0926 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte- human fibrinogen mixture (Sigma-Aldrich). Then ...
-
bioRxiv - Bioengineering 2023Quote: ... 1µL thrombin from human plasma was added to 3.5µL of the cardiomyocyte-human fibrinogen mixture (Sigma-Aldrich) and 2µL of the mixture is carefully pipetted into the microwell ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Immunology 2022Quote: ... containing 0.25% with 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) (Sigma, St. Louis, MO) for two minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 98% EDC [1-(3-Dimethylaminopropyl)-3-ethyl carbodiimide hydrochloride] were purchased from Sigma Aldrich. SYBR Safe nucleic acid gel staining dye was obtained from Invitrogen (Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Immunology 2024Quote: ... 4% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate hydrate (CHAPS; Sigma-Aldrich, Cat. No. 226947)] ...
-
bioRxiv - Cell Biology 2020Quote: ... Cyanine 3 (NC, Sigma-Aldrich) was used as a control of transfection efficiency.
-
bioRxiv - Developmental Biology 2021Quote: ... 3-bromopyruvate (Sigma Aldrich #16490) or 2-deoxy-D-glucose (CARLROTH #CN96.3 ...
-
bioRxiv - Developmental Biology 2021Quote: The drug 3’-dA (Sigma) was dissolved in M16 medium (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... blocked with 3% BSA (Sigma) in PBS for 2 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 3×FLAG peptide (F4799, Sigma), Expi29™ expression medium (A1435101 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 min (3–18, Sigma) after homogenization by a 5 ml glass-glass douncer (Braun ...
-
bioRxiv - Molecular Biology 2021Quote: ... also containing 3% BSA (Sigma) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Benzonase (Millipore, 70746-3). The lysates were homogenized by sonication and centrifuged for 1 h ...
-
bioRxiv - Genetics 2019Quote: ... and 3 nM TTNPB (Sigma). Day 8 ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 mM MgCl2 (Sigma-Aldrich), 0.7 % Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2020Quote: ... 3-isobutyl-1-methylxanthine (Sigma); Glyh-101 (a gift from the Cystic Fibrosis Foundation Therapeutics and Robert Bridges ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 mM CHIR99021 (GSK3i, Sigma), and 1000 units/mL LIF (Millipore ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3% BSA (Sigma-Aldrich, A3311), and 0.2% Triton X-100 (Sigma-Aldrich ...