Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for Granzyme B GZMB Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... HEK293 cells were transfected using Polyethylenimine (PEI,Sigma Aldrich; St. Louis, Missouri, USA). PEI and vector media were combined in a ratio of 5µL PEI and 0.5µg vector in 250µL of serum-free DMEM and incubated for 10 min at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... HEK293 cells were cultured in high glucose Dulbecco’s modified Eagle’s medium (DMEM; Sigma) supplemented with 10% fetal bovine serum at 37°C in 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: HEK293 or 293T cells were cultured in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich) supplemented with 10% fetal calf serum ...
-
bioRxiv - Microbiology 2022Quote: ... and HEK293 cells and were grown in Dulbecco’s Modified Eagle Medium (DMEM) (Sigma) supplemented with 10% v/v foetal calf serum (FCS ...
-
bioRxiv - Microbiology 2023Quote: HEK293 T cells were maintained in Dulbecco’s modified Eagle medium (DMEM; Sigma, D6429) supplemented with 10% heat-inactivated FBS (Atlanta Biologicals ...
-
bioRxiv - Developmental Biology 2024Quote: HEK293 cells were seeded onto glass coverslips coated with Poly-L-Lysine (Sigma) and left to adhere overnight prior to transfection with plasmid DNA ...
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (L5288 from Sigma), 5µM ...
-
bioRxiv - Genomics 2019Quote: ... and B-actin (A5441, Sigma) were used at dilution 1:1000 and 1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... amphotericin B (Sigma - Aldrich, Germany) (from 0.125 to 16 µg/mL) ...
-
bioRxiv - Cell Biology 2019Quote: ... Latrunculin B (Sigma, 5 µM) was added to the culture media for 10 min before 20 min of rapamycin ...
-
bioRxiv - Microbiology 2021Quote: ... and polymyxin B (Sigma-Aldrich), were serially diluted 1 in 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... antifoam B (Sigma, 1:5000), and 40U/mL RNAsin (Promega)) ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5μg/mL Polymyxin B (Sigma) was used as permeabilizing agent in the positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma). Spinner-adapted L929 cells (originally obtained from the Bernard Fields laboratory ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:5000 Antifoam B (Sigma) and lysed by vortexing with acid-washed glass beads for 2 min followed by 2 min on ice for three cycles ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 mM b-mercaptoethanol (Sigma) and 1000 U/mL of LIF (Chemicon) ...
-
bioRxiv - Neuroscience 2021Quote: ... rhodamine B (RhoB; Sigma Aldrich), Rp-8-Br-PET-cGMPS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by pestle B (Sigma), and filtered through a 70-um cell strainer (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... b-actin (Sigma, AC-15), P-eIF2a (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... 200 nM b-mercaptoethanol (Sigma), 1 % sodium pyruvate (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... B-Actin (A1978; Sigma-Aldrich).
-
bioRxiv - Immunology 2020Quote: ... Amphotericin B (all Sigma-Aldrich), and BD Difco™ BBL™ Middlebrook ADC Enrichment and incubated at 37 °C with agitation with a magnetic stir bar ...
-
bioRxiv - Microbiology 2019Quote: As hygromycin B (Sigma-Aldrich) was used as the selection marker during transformations ...
-
bioRxiv - Microbiology 2020Quote: ... Polymyxin B nonapeptide (PMBN; Sigma), a non-toxic polymyxin derivative ...
-
bioRxiv - Cell Biology 2021Quote: ... Rhodamine B solution (Sigma, 02558) was diluted to 10% in water and image stacks were acquired in the red channel during laser application ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amphotericin B (Sigma, Cat#:A2942) at 250µg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... and B-ACTIN (Sigma A5441).
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma) or infection medium (growth medium containing 2% FBS) ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.1% amphotericin B (Sigma). SV-40 immortalized endothelial cells (SVECs ...
-
bioRxiv - Developmental Biology 2021Quote: ... Rhodamine B (Sigma, Cat R8881) was co-injected with MOs as a dye ...
-
bioRxiv - Bioengineering 2022Quote: ... amphotericin-B (0.2 mL, Sigma), and cell medium (6.75 mL) ...
-
bioRxiv - Immunology 2022Quote: ... Staphylococcus enterotoxin B (SEB; Sigma) stimulation (200ng/ml ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and amphotericin B (Sigma-Aldrich) was performed by determining the minimal inhibitory concentration (MIC ...
-
bioRxiv - Neuroscience 2022Quote: ... 1.1ug/mL Amphotericin B (Sigma), 20ug/mL gentamycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... 1.1ug/mL Amphotericin B (Sigma), 20ug/mL gentamycin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... 1.1ug/mL Amphotericin B (Sigma), 20ug/mL gentamycin (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... B hardener (44612, Sigma-Aldrich); D hardener (44614 ...
-
bioRxiv - Microbiology 2022Quote: ... and polymyxin B (Sigma-Aldrich) was prepared to 50 mg ml-1 in dH2O ...
-
bioRxiv - Genomics 2022Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Latrunculin B (Sigma #L5288-1MG) at a final concentration of 10 μM was added to the media.
-
bioRxiv - Microbiology 2022Quote: ... amphotericin B (Sigma-Aldrich, #A9528) (0.03-16 μg/ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... cytochalasin B (Millipore-Sigma, #C6762), cytochalasin D (Millipore-Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... b-Actin (Sigma-Aldrich, A5316), Progranulin (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: ... Part B: 0.3g BactoAgar (Sigma) solved in 50ml water in a microwave then supplement with 1.23ml 5M NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... cytochalasin B (Millipore-Sigma, #C6762), cytochalasin D (Millipore-Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... B-Actin (Sigma-Aldrich, A5441), γH2A.x (Millipore ...
-
bioRxiv - Biophysics 2023Quote: Bradford reagent (B 6916, Sigma) was used to determine the concentration of proteins in egg extract and other solutions in this study ...