Labshake search
Citations for Millipore Sigma :
301 - 350 of 10000+ citations for 1 Ethylbenz cd indol 2 1H ylidene malononitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Muscle sections were blocked for 1h with a solution containing 4% BSA (#A7030, Sigma) in PBS and then incubated with primary antibodies O.N ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1h at RT and developed using Immobilon(tm) Western Chemiluminescent HRP Substrate (Millipore). Detection and quantification of chemiluminescence intensities were quantified by using Chemidoc™ imaging system ...
-
bioRxiv - Pathology 2022Quote: ... Filtered samples (100µL) were incubated (1h; RT) with MOPS buffer (5mM, 100µL, Sigma, #M1254), Bathophenanthrolinedisulfonic acid disodium salt hydrate (BPT ...
-
bioRxiv - Cell Biology 2020Quote: ... Muscle sections were blocked for 1h with a solution containing 4% BSA (#A7030, Sigma) in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... 1H-15N HSQC and If sample contained tannic acid (Sigma Aldrich, St. Louis, MO), pH was checked after addition of tannic acid to ensure no changes in pH ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were pretreated for 1h with STAT 6 inhibitor AS1517499 (1µM; Sigma Aldrich SML1906), eIF4E/eIF4G interaction inhibitor 4EGI-1 (40 µM ...
-
bioRxiv - Physiology 2023Quote: ... for 1h at RT and developed using Immobilon™ Western Chemiluminescent HRP Substrate (Millipore). Detection and quantification of chemiluminescence intensities were quantified by using ChemidocTM imaging system and Image Lab 5.2.1 software (BioRad) ...
-
bioRxiv - Neuroscience 2024Quote: ... Slides were incubated for 1h in blocking solution [5% goat serum (Sigma Aldrich, D9023); 1% BSA (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were permeabilized for 1h in PBS with 0.5% Triton-X100 (T9284, Sigma-Aldrich) before being incubated overnight at 4°C with primary antibodies diluted in PBS containing 0.5% Triton-X ...
-
Sex-specific perturbations of neuronal development caused by mutations in the autism risk gene DDX3XbioRxiv - Neuroscience 2024Quote: ... and blocked for 1h at RT in 10% donkey serum (Sigma-Aldrich Inc, #D9663)/0.3% Triton-X 100 in 1X TBS ...
-
bioRxiv - Cell Biology 2024Quote: The CDS of AcCaspA was subcloned into pET-28a (+) expression vector (Novagen, Madison, WI, USA) and expressed as His-tagged protein ...
-
bioRxiv - Molecular Biology 2024Quote: ... we used two different siRNAs targeting METTL3 CDS (CUGCAAGUAUGUUCACUAUGA[dT][dT], AGGAGCCAGCCAAGAAAUCAA[dT][dT], Sigma) at concentration 40 nM (20 nM each siRNA) ...
-
bioRxiv - Immunology 2022Quote: ... an overlay (1:1 of 2% methylcellulose (Sigma) and culture media ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), Tim23 (BD Transduction Labs ...
-
bioRxiv - Cell Biology 2023Quote: ... Tubulin [B-5-1-2] (Sigma, 1:5000), HSP60 [LK1] (Thermo Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Cholesterol addition experiments were performed in MCF7 cells expressing GFP tagged Cavin1 with serum starvation (Serum free DMEM + 1% BSA, 1h) prior to the addition of water soluble analog of Cholesterol (Sigma-Aldrich Cat. No. C4951). Cells were incubated in DMEM media containing Cholesterol for 40 min at 37°C with immediate fixation using 4% paraformaldehyde in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2021Quote: ... the membranes were washed in PBS-T for 40 min and the bound proteins were visualized with anti-FLAG-HRP antibodies (1:10000 in PBS-T for 1h, Sigma-Aldrich, Cat. no: A8592). All steps were performed at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... and drugs (2-deoxy-d-glucose (2-DG, SIGMA, 1 mM), N-acetylcysteine (NAC ...
-
bioRxiv - Biochemistry 2023Quote: 2-Pyridinecarboxaldehyde (1) and 6-(1-piperazinylmethyl)-2-pyridinecarboxaldehyde bistosylate salt were purchased from Sigma-Aldrich. 5-Ethynylpicolinaldehyde (“alkyne-2PCA” ...
-
bioRxiv - Cell Biology 2021Quote: ... 4EBP1 shRNA (TRCN0000335449) and EIF4G1 shRNA (TRCN0000096812) targeting the Coding Sequence (CDS) were all from Sigma. Lentiviral backbone pLV-EF1a-IRES-Neo was a gift from Tobias Meyer (Addgene plasmid #85139) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Methyl-β-cyclodextrin (Mβ-CD) and other reagents were obtained from Sigma-Aldrich (St. Louis, MO) unless otherwise specified ...
-
bioRxiv - Microbiology 2020Quote: ... The full TcAc_CPI cds (TcCLB.510857.10) was cloned into the pET32-Ek/LIC vector (Novagen®) resulting in the pET32/TcAc_CPI construct (primers 33 ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were blocked in non-fat milk with 0,1% Tween 20 for 1h (Sigma-Aldrich), and incubated with antibodies as indicated in Table S2 at 4°C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were permeabilized and blocked for 1h at room temperature in 0.3% Triton (Sigma-Aldrich)/5% goat serum (Jackson Laboratories) ...
-
bioRxiv - Neuroscience 2021Quote: ... Blocking was performed for 1h at RT using 20% normal goat serum (S26, Sigma-Aldrich) in Tris-NaCl blocking buffer (TNB) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were incubated for 1h in base assay medium (D5030, Sigma Aldrich, Merck, Darmstadt, Germany) supplemented with 2 mM glutamine ...
-
bioRxiv - Developmental Biology 2021Quote: ... except that embryos were incubated for 1h in pre-equilibrated KSOM (without amino acids; Millipore), prior to incubation in KSOM containing 500 μm HPG or 1 mM EU for 2h ...
-
bioRxiv - Biophysics 2020Quote: ... The purified protein was incubated and for 1h at 37°C with bovine thrombin (Sigma) in a 1000:1 molar ratio ...
-
bioRxiv - Microbiology 2023Quote: ... Co-immunoprecipitated proteins were eluted for 1h at 4°C with 3X FLAG peptide (Sigma) in TBS (pH 7.4) ...
-
bioRxiv - Systems Biology 2023Quote: ... samples were incubated for 1h in PBS supplemented with 0.3% Triton X-100 (Sigma-Aldrich), 1% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: ... The collected epidermis and dermis were pre-fixed 1h in 4% paraformaldehyde (PFA, Sigma-Aldrich), rinsed three times with PBS for 5 min and conserved in PBS with 0.2% azide at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... MDMs were also pre-treated for 1h with a TLR3/dsRNA complex inhibitor (Merck Millipore) 5 µM final concentration ...
-
bioRxiv - Neuroscience 2024Quote: ... Where indicated iAstrocytes were pre-incubated for 1h with 0.5 µM Avasimibe (PZ0190, Sigma Aldrich), 10µM Cholesterol (C4951 ...
-
bioRxiv - Plant Biology 2024Quote: ... the supernatant was derivatized using cysteamine (0.25 M; pH 8; 1h; room temperature; Sigma-Aldrich), afterwards ...
-
bioRxiv - Neuroscience 2022Quote: ... + 1% 2-mercaptoethanol (Millipore-Sigma, 63689) before being flash-frozen on dry ice.
-
bioRxiv - Neuroscience 2022Quote: ... + 1% 2-mercaptoethanol (Millipore-Sigma, 63689) before being flash-frozen on dry ice.
-
bioRxiv - Immunology 2021Quote: ... containing 1% 2-mercaptoethanol (Sigma-Aldrich) for extraction of RNA ...
-
bioRxiv - Genetics 2020Quote: ... 1 M TCEP (Sigma C4706–2) was added to final concentration of 4 mM to 1 mg of protein and incubated for 30 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... ionomycin (2 μg ml−1, Sigma) and Golgi-plug (1.5 μl ml−1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10% 1-methyl-2-pyrrolidone (Sigma), 40% polyethylene glycol 400 (PEG ...
-
bioRxiv - Microbiology 2020Quote: ... containing 1% 2-Mercaptoethanol (Sigma Aldrich). Protein lysates were electrophoresed using 10% Mini-PROTEAN TGX gels (BIO-RAD ...
-
bioRxiv - Microbiology 2020Quote: ... and 1% 2-mercaptoethanol (Sigma Aldrich)] and submitted to five freeze-thawing cycles (−80 °C to 65 °C) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 U mL-1 heparin (Sigma), 1 μg mL-1 hydrocortisone (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μM WIN55,212-2 mesylate (Sigma), 10 μM ZD7288 (Tocris).
-
bioRxiv - Bioengineering 2020Quote: ... and MAP 2 (1:50; Millipore) were added to the cell medium for staining overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 1·2 % carmine red (C1022, Sigma) was added to the sucrose solution ...
-
bioRxiv - Pathology 2021Quote: ... 1% phosphatase inhibitor cocktail 2 (Sigma), 1% phosphatase inhibitor 3 (Sigma) ...
-
Intrarenal B cells integrate in situ innate and adaptive immunity in human renal allograft rejectionbioRxiv - Immunology 2020Quote: ... with 1% 2-mercaptoethanol (Sigma-Aldrich)) ...
-
bioRxiv - Immunology 2021Quote: ... with 1% 2-mercaptoethanol (Sigma Aldrich). The sorted APC subsets ...
-
bioRxiv - Neuroscience 2022Quote: ... 1–2% agarose (Type IIIA, Sigma) was placed over the dura at the start of each session ...