Labshake search
Citations for Millipore Sigma :
551 - 600 of 10000+ citations for 1 Ethylbenz cd indol 2 1H ylidene malononitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... 50× 1-phenyl-2-thiourea (PTU; Sigma-Aldrich) was added to 0.3× Danieau Buffer at a final concentration of 1 × PTU to inhibit the formation of pigmen ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat anti-Laminin-2 (1:500; Sigma; L0663), and rat anti-Ki67 (1:500 ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 IU ml−1 heparin (Sigma-Aldrich, H3149), 5% human solvent detergent pooled plasma AB (Gemini ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1× phosphatase inhibitor cocktail 2 (Sigma, P5726-5ML), pH 8.2] on ice for 10 min.
-
bioRxiv - Cell Biology 2024Quote: ... Phosphatase inhibitors (Cocktail 2, 1:100, Sigma-Aldrich) and protease inhibitors (P8340 ...
-
bioRxiv - Plant Biology 2021Quote: ... a 2.25-kb fragment containing the PHOT1 CDS was amplified by PCR with KOD hot start DNA polymerase (Novagen) using PHOT1 FW and PHOT1 RV primers (Table 1) ...
-
bioRxiv - Microbiology 2021Quote: An shRNA lentiviral vector targeting the CDS region of PROX1 mRNA (Clone ID: NM_002763.3-531s21c1) was purchased from Sigma-Aldrich. Lentiviral particles were prepared by transfecting HEK293T cells with pLKO.1-shPROX1 (or pLKO.1-shControl) ...
-
bioRxiv - Microbiology 2023Quote: ... CHOZN® CHO K1 cells were thawed and maintained in EXCELL CD CHO Fusion medium (Sigma, Cat. No. 14365C) containing 4 mM L-glutamine at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... four different siRNAs targeting ALKBH5 CDS (ACAAGUACUUCUUCGGCGA[dT][dT], GCGCCGUCAUCAACGACUA[dT][dT], CUGAGAACUACUGGCGCAA[dT][dT], AAGUCGGGACUGCAUAAUUAA[dT][dT], Sigma) were used at concentration 20 nM (5nM each siRNA) ...
-
bioRxiv - Immunology 2021Quote: ... for 1h followed or not by NLRP3 activation with 20 μM nigericin (Sigma-Aldrich, Cat. no: N7143-5MG) for 1.5 h ...
-
bioRxiv - Cell Biology 2021Quote: ... differentiated HNEC cultures were incubated for 1h in ALI-differentiation medium supplemented with 5 µg/ml polybrene (Millipore) before infection.
-
bioRxiv - Biophysics 2020Quote: ... Micropatterns were printed for 5 min with specifically designed chrome masks and coated for 1h at 5% CO2 and 37°C with 50μg/mL fibronectin and 20μg/mL Alexa 546–fibrinogen (Sigma) diluted in distilled water ...
-
bioRxiv - Biophysics 2021Quote: ... and kept at 4°C for 1h in KB solution containing 50 mg/ml polyvinylpyrrolidone (Sigma, Chemical Co.). Finally ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1h at RT, blocked for 1h at RT in blocking solution (0.3% Triton X-100, 0.2% BSA (A4503, Sigma), and 5% goat serum (005-000-121 ...
-
bioRxiv - Neuroscience 2023Quote: ... experiments were conducted in the presence of 10μM DNQX [6,7-Dinitroquinoxaline-2,3 (1H,4H-dione)] (Sigma, Cat#D0540)] and 50μM APV [DL-2-Amino-5-phosphonopentanoic acid] (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mg of proteins were subsequently incubated for 1h with 10 μl of FAM134B or FAM134C antibodies (Sigma Prestige-HPA012077 and -HPA016492 ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for an additional 1h or 2h with 5 µg/mL actinomycin D (ActD) (Sigma-Aldrich). cDNA was synthesized with SuperScript III (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were permeabilized for 1h in 1X PBS containing 0.3% or 0.15% Triton X-100 (#X100-100ML, Sigma), and 10% donkey serum (#S30-100ml ...
-
bioRxiv - Cell Biology 2020Quote: ... at 1:1000 dilution and monoclonal antibody B-5-1-2 (Sigma) at 1:1000 dilution to detect α-tubulin as loading control.
-
bioRxiv - Biochemistry 2021Quote: ... α-TUBULIN (ms, clone B-5- 1-2, Sigma T9026, 1:5000), rabbit IgG (gt ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 100 μL 1×PBS 1% saponin (Sigma-Aldrich, Cat # 8047-15-2) were added ...
-
bioRxiv - Cell Biology 2021Quote: ... CCCP 2 µM and Antimycin A 1 µM + 1 µM Rotenone (Sigma). Measurements were taken over 2-min intervals ...
-
bioRxiv - Microbiology 2020Quote: ... 2 and 3 emulsified 1:1 in Freund’s incomplete adjuvant (Sigma-Aldrich) on days 0 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal against alpha-tubulin (1:1000; b5-1-2, Sigma, T6074). Actin was stained using 100 nM of phalloidin-iFluor488 for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... is added 1:1 together with 2 µg/mL doxycycline (Sigma-Aldrich) to induce TetO gene expression ...
-
bioRxiv - Microbiology 2024Quote: ... + 2% HI FBS + 1% Anti-anti + 1% (w/v) carboxymethylcellulose (Sigma-Aldrich)) was added to the plate (180 µL/well) ...
-
bioRxiv - Microbiology 2024Quote: ... + 2% HI FBS + 1% Anti-anti + 1% (w/v) carboxymethylcellulose (Sigma-Aldrich)) was added to cells ...
-
bioRxiv - Plant Biology 2024Quote: ... anti-microtubule antibody (1:2,000; clone B-5-1-2; Sigma- Aldrich), and ECL anti-mouse IgG horseradish peroxidase-linked whole antibody (1:1,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 DIV differentiated cells were treated with 1 µM CDK1/2 inhibitor III (Millipore, 217714) in control medium supplemented with 2% FBS for 24 h ...
-
bioRxiv - Neuroscience 2022Quote: ... and stained with microtubule-associated protein 2 (MAP 2) antibody (1:500, Sigma aldrich M9942), ALK (1:500 ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were resuspended in pre-chilled 1mL of 2:2:1 acetonitrile (34851, Millipore Sigma) + methanol (439193 ...
-
bioRxiv - Biochemistry 2022Quote: ... they were cultivated 72 hours in the presence of 2 μM DL-threo-1-phenyl-2-palmitoylamino-3-morpholino-1-propanol (PPMP) (Sigma-Aldrich) to inhibit the synthesis of glucosylceramide-based GSLs 75 and incubated with fluorescent SaroL-1 as previously described ...
-
bioRxiv - Neuroscience 2022Quote: ... For the blockade of cholinergic receptors in CA1 200nl of atropine (2 mM) and mecamylamine (2 mM) (1:1) (Sigma Aldrich) were microinjected at 1.2mm DV (IM-9B microinjector ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by incubation with anti-Sulf-1/2 primary antibody (anti-Sulf-1: rabbit polyclonal, Sigma, SAB1410410, anti-Sulf-2: rabbit monoclonal clone 2B4, Sigma, MABC584) overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 μL of 2 mg/mL IG[pS]TENLK was mixed 1:1 with 250 mM Ba(OH)2 (Sigma-Aldrich) in a total volume of 200 μL and incubated at 37°C for 90 min ...
-
bioRxiv - Bioengineering 2024Quote: The alkaline comet assay was performed by mixing 1.5 × 105 cells 1:1 with 2 % low melting point agarose (2-Hydroxyethylagarose, Type VII, Sigma-Aldrich, A4018) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... aeruginosa strains were routinely refreshed from frozen stocks at -80°C and maintained on YPD (1% Bacto yeast extract, 2% Bacto peptone, 2% dextrose, 2% Bacto agar) plates or Pseudomonas isolation agar (Sigma-Aldrich) for in vitro experiments and LB agar (10 g/liter Bacto tryptone ...
-
bioRxiv - Microbiology 2021Quote: ... The rabbit polyclonal anti‐Per1 antibody was generated against recombinant Per1 protein (recPer1) corresponding to bases 55‐462 of per1 CDS (Aste010406) expressed in pET‐42a (Novagen) commercially (GL Biochem Ltd ...
-
bioRxiv - Cell Biology 2020Quote: ... and then VSMCs were treated in micro-volume by a pipette with CD (10 μmol/L; Sigma, St. Louis, MO), with ML7 (10 μmol/L ...
-
bioRxiv - Genetics 2021Quote: ... The plasmids for inducible expression of the human CNBP counterpart was generated by cloning the FLAG epitope CDS fused in-frame with the 3′ end of the hCNBP CDS (CNBP-201 splice variant, CCDS 3056.1) into the UAS-attB vector (Genewiz, SIGMA-ALDRICH). The dCNBP-3HA-res or UAS-hCNBP-FLAG were injected in y1 w67c23 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Individual embryos were transferred into tubes kept on ice filled with 200 µL cell dissociation solution (CDS; 5 ml of Ringers’ solution (96724, Sigma), 1 tablet of Complete Mini EDTA-free (11836153001 ...
-
bioRxiv - Microbiology 2023Quote: ... Cell-laden filters were suspended in 2-ml bead beater tubes (SSIbio, # 21276) containing 1 ml of fresh metabolite extraction solvent (2:2:1 ratio of acetonitrile (Sigma-Aldrich, # 900667), methanol (>99.8%) ...
-
bioRxiv - Neuroscience 2024Quote: ... the samples were incubated with fluorescent dye-conjugated secondary antibodies at RT for 2 hours with 1% NDS in PBST with 4’,6-diamidino-2-phenylindole (DAPI, 1:1000, Sigma-Aldrich, D9542). Afterward ...
-
bioRxiv - Immunology 2021Quote: ... per condition were pre-incubated for 1h prior to viral stimulation or infection with inhibitors MG132 (10μM; Merck Millipore) BafA1 (0.5μM ...
-
bioRxiv - Neuroscience 2021Quote: ... and the next day with laminin for 1h at RT (5µg/mL in distilled water) (Sigma-Aldrich, MO, USA). Neuronal cells were plated directly on top of the electrodes and treated with EVs or recombinant proteins ...
-
bioRxiv - Neuroscience 2021Quote: ... washed 3 times for 5 min with PBS and permeabilized for 1h at room temperature (permeabilization buffer: 2,5% donkey serum (Sigma), 1% BSA ...
-
bioRxiv - Cancer Biology 2021Quote: ... Whole cell extracts (500 μg per IP) were immunoprecipitated for 1h using a PHGDH-specific antibody (Merck Sigma, HPA021241) complexed with Dynabeads Protein A (Life Technologies) ...