Labshake search
Citations for Millipore Sigma :
3351 - 3400 of 10000+ citations for Mouse IgG2a Isotype Control Antibody Biotin 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Iba1 (rabbit, WAKO;, RRID: AB_839504) were visualized by avidin-biotin technique with 3,3-diaminobenzidine (DAB, Sigma) according to standard procedures of the UKE Mouse Pathology Facility using the ultraView Universal DAB Detection Kit (Ventana) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Additional blocking by incubation with avidin and biotin (both 0.001% in PB, Sigma-Aldrich, Darmstadt, Germany) for 30 min and a 10 min wash with PBST in between were carried out before incubation with the blocking solution ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by avidin-biotin complex and developed in solution containing 0.025% 3,3’-diaminobenzidine tetrahydrochloride (Sigma-Aldrich), 10 mM imidazole ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubes were kept at 37°C in a water bath and D-biotin (B4501; Sigma-Aldrich) was added at a final concentration of 500 μm ...
-
bioRxiv - Cell Biology 2020Quote: The mixture was incubated with Dibenzocyclooctyne-PEG4-biotin conjugate (Sigma-Aldrich #760749; 50 μM final concentration) in a reaction volume of 100 μl for 1 h on a rotator in slow motion (9 rpm ...
-
bioRxiv - Microbiology 2022Quote: ... Unconjugated biotin was removed by centrifugation using a 50 kDa Amicon Ultra size exclusion column (Millipore). To determine the average number of biotin molecules bound to each molecule of F ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transferred to ice and surface biotin was cleaved with 60 mM MesNa (Sigma, 63705) in MesNa buffer (50 mM Tris-HCl [pH 8.6] ...
-
bioRxiv - Bioengineering 2019Quote: ... terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL) staining (ApopTag kit; Millipore, Temecula, CA) was performed according to manufacturer’s instruction on tissue sections corresponding to locations receiving the highest number of MR-ARFI repetitions from sheep in the high dose group.
-
bioRxiv - Immunology 2020Quote: ... Unconjugated biotin was removed by centrifugation using a 50 kDa Amicon Ultra size exclusion column (Millipore). To determine the average number of biotin molecules bound to each molecule of F ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% biotin tubulin and 4% HiLyte647-tubulin) in the presence of 2.5 mM GTP (Sigma-Aldrich) and 20 μM Taxol (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... the following reagents were added: 10 μL of 10 mM biotin picolyl azide (Sigma Aldrich, 900912) in DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were treated with 1 μg/mL doxycycline and 50 μM biotin (Sigma-Aldrich # B-4639) for 24 hours for BirA* fusions or 30 minutes for miniTurbo fusions ...
-
bioRxiv - Immunology 2024Quote: ... 8 µM 6-biopterin,1 mg/L biotin and 1x RPMI 1640 vitamins solutions (Sigma, USA). Parasites in culture were passaged to fresh medium at a one 20th-50th dilution once a week.
-
bioRxiv - Genomics 2022Quote: ... The chips were further reacted with PC biotin-PEG3-NHS ester (0.2 mg/ml, Sigma-Aldrich) for 1 hour and then then labeled with streptavidin conjugated with Alexa FluorTM 568 (0.04 mg/ml in depc-PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated biotin was removed by washing the mRNA three times with H2O (molecular biology grade, Millipore) in an Amicon membrane centrifugal concentrator with a molecular weight cutoff (MWCO ...
-
bioRxiv - Biochemistry 2023Quote: ... the following reagents were added: 10 μL of 10 mM biotin picolyl azide (Sigma Aldrich, 900912) in DMSO ...
-
bioRxiv - Immunology 2024Quote: ... Cell surface-bound Abs were detected with specific biotin-conjugated secondary Ab (1/500; Sigma-Aldrich).
-
bioRxiv - Bioengineering 2024Quote: ... in 950 µL PBS for 2 h at room temperature (RT) with Biotin-NHS (H1759, Sigma) in a 1:20 molar ratio (G-CSFR:Biotin-NHS) ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatant from this clarification step were incubated with mouse anti-FLAG antibody (Sigma, clone M2 1µg/ml) over night at 4ºC with gentle rocking ...
-
bioRxiv - Biochemistry 2021Quote: ... membranes were incubated with TBST-Blotto containing primary monoclonal mouse anti-FLAG M2 antibody (1:2,000 dilution, Sigma) or monoclonal mouse anti-GAPDH antibody (1:2,000 dilution ...
-
bioRxiv - Systems Biology 2020Quote: ... samples were analyzed for β-actin expression using a mouse anti-β-actin antibody (1:5,000, Sigma Aldrich) and a HRP-labeled goat anti-mouse antibody (1:10,000 ...
-
bioRxiv - Immunology 2021Quote: ... Cell lysates were reprobed with a mouse monoclonal antibody anti-β-actin (clone C4, Millipore; 1:5,000 dilution).
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated in a primary antibody solution containing 1:250 mouse anti-NeuN (Millipore; MA, USA), 1:200 goat anti-DCX(Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following antibodies were used: mouse anti-acetylated tubulin (clone 6-11b-1, Sigma-Aldrich, diluted 1:2000) and goat anti-mouse Alexafluor 488 (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... The following primary antibody were used in this study: β-tubulin III (mouse, Sigma Aldrich T8660, 1:1000), TH (rabbit ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a mouse anti-acetylated α-tubulin antibody (clone 6-11B-1, Millipore-446 Sigma, #MABT868, 1:500) to co-stain cell boundaries ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a mouse anti-acetylated α-tubulin antibody (clone 6-11B-1, Millipore-446 Sigma, #MABT868, 1:500) to co-stain cell boundaries ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were incubated with HRP-linked secondary antibodies anti-mouse IgG (1:5000, A6782, Sigma-Aldrich, MO, USA) and anti-rabbit IgG (1:5000 ...
-
bioRxiv - Molecular Biology 2021Quote: PLA was performed using DuoLink red detection kit and DuoLink anti-mouse and anti-rabbit antibodies (Millipore-Sigma Cat ...
-
bioRxiv - Genetics 2019Quote: ... The bound anti-BrdU antibody was subsequently detected by anti-mouse IgG-FITC conjugate (Sigma, dilution 1:64) under a fluorescence microscope after mounting the ganglia in antifade (Sigma).
-
bioRxiv - Cell Biology 2020Quote: The primary antibodies used (with their respective working dilutions) were: anti-FLAG (Sigma F1804, mouse, WB: 1/1000), anti-pan-acetyl lysine (AcK ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were used: Monoclonal mouse anti-FLAG M2-Peroxidase (HRP) (Sigma-Aldrich; A8592, dilution: 1:1,000). Monoclonal mouse anti-Actin clone C4 (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... The following primary antibodies were used for western blotting studies: mouse anti-α-tubulin DM1A (Sigma-Aldrich, RRID:AB_477593) used at 1:10000 ...
-
bioRxiv - Microbiology 2019Quote: ... The coverslips were then incubated with a 1:5,000 dilution of mouse monoclonal M2 anti-FLAG antibody (Sigma) and a 1:10,000 dilution of rabbit polyclonal anti-S ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were then rinsed in PBS and incubated with goat anti-mouse secondary antibody (1:200, Sigma-Aldrich) for one hour at room temperature on a shaker ...
-
bioRxiv - Plant Biology 2019Quote: ... StrepII-tagged proteins were detected using Strep-Tactin AP conjugate (IBA) or a mouse monoclonal StrepII antibody (Sigma). Further primary antibodies used were α-mCherry (Abcam ...
-
bioRxiv - Biochemistry 2020Quote: ... Lamin proteins were detected using mouse anti-myc antibodies (clone 4A6, Millipore cat #05-724; 1:10000 dilution) decorated with goat anti-mouse secondary IRDye 680RD antibodies (LI-COR) ...
-
bioRxiv - Genomics 2020Quote: ... incubated with 1:200 diluted anti-LINE-1 ORF1p mouse monoclonal antibody (clone 4H1, Sigma MABC1152, Lot 3493991), and then with 1:400 diluted Donkey-anti-Mouse-Alexa Fluor 594 second antibody (Invitrogen 21203).
-
bioRxiv - Cell Biology 2019Quote: The following primary antibodies were used in this study: mouse anti-α-tubulin (clone DM1A, T6199; Sigma-Aldrich), rabbit anti-MAP2 (AB5622 ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated overnight at 4 °C with a mouse anti-tyrosine hydroxylase antibody (anti-TH, Sigma, T1299) and a chicken anti-eYFP antibody (Life technologies Molecular Probes ...
-
bioRxiv - Neuroscience 2021Quote: The following primary antibodies were used for immunostaining: monoclonal mouse anti-mHTT (1:100; mEM48 Millipore; Cat. # MAB5374), monoclonal mouse anti-huntingtin (1:1000 ...
-
bioRxiv - Bioengineering 2020Quote: ... We used the following primary and secondary antibodies and dilutions: mouse anti-α-tubulin 1:150 (Sigma-Aldrich), goat anti-collagen IV 1:50 (Southern Biotech) ...
-
bioRxiv - Cell Biology 2021Quote: The following primary antibodies were used for immunocytochemistry and Western blot experiments: mouse anti-FLAG M2 (Sigma-Aldrich, cat #F3165 ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were incubated in a mouse monoclonal primary antibody against oxytocin (1:10,000, MAB5296, Millipore, Burlington, MA, USA) or rabbit polyclonal antibody against NeuN (1:20,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were stained with the following primary antibodies: mouse monoclonal anti-NeuN (1:200, #MAB377, Millipore, Billerica, MA), rat monoclonal anti-CTIP2 (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was incubated overnight with a 1:2000 dilution of mouse monoclonal anti-FLAG antibody (Sigma-Aldrich) in blocking solution at 4 ºC with mild shaking ...
-
bioRxiv - Microbiology 2021Quote: ... Bound antibodies were probed using 50 μl/well of 1:1,000 of anti-mouse IgG HRP (Sigma–Aldrich) and 75 μl/well of tetramethylbenzidine substrate (Sigma–Aldrich) ...
-
bioRxiv - Immunology 2020Quote: ... and transgene expression was confirmed by flow cytometry using a mouse anti-FLAG M2 antibody (F1804, Sigma-Aldrich) together with an APC or PE-conjugated secondary anti-mouse antibody (Jackson ...
-
bioRxiv - Neuroscience 2020Quote: ... The γ-H2AX foci were detected with mouse monoclonal antibody anti-phospho-Histone H2AX (Cat #05-636, Millipore) and goat anti-mouse IgG crossadsorbed secondary antibody ...