Labshake search
Citations for Millipore Sigma :
3301 - 3350 of 10000+ citations for Mouse IgG2a Isotype Control Antibody Biotin 15H6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... or control rabbit IgG using Magna ChIP A/G kit (Millipore), as previously described (Chatterjee et al. ...
-
bioRxiv - Immunology 2020Quote: ... and positive control wells included SEB (0.5 μg/ml; Sigma-Aldrich). Assays were incubated for 24 hr at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... as control or 1 mg/ml of RNase A (Sigma, #R4642) for 15 min at 37°C before adding the recombinant protein for overnight incubation.
-
bioRxiv - Immunology 2021Quote: ... 10 µg/ml Staphylococcus enterotoxin B (SEB, Sigma-Aldrich; positive control), or 10% DMSO (negative control) ...
-
bioRxiv - Neuroscience 2021Quote: ... or against β-Actin as a loading control (1:5000, Sigma). The target protein on the membrane was visualized with ECL Select (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... One microgram of BSA (negative control; Sigma-Aldrich, St. Louis, MO) or FH from mouse or quail was coated onto microtiter plate wells by incubating the plate for overnight at 4ºC ...
-
bioRxiv - Neuroscience 2019Quote: ... as control siRNA for Luciferase was used (5′-uaaggcuaugaagagauac-3′; Sigma). Immediately before transfection 2–4 × 105 cells were seeded in 6-well plates in 1.4 ml of medium containing 10% fetal serum ...
-
bioRxiv - Cell Biology 2019Quote: ... or non-target controls (SHC202) (CCGGCAACAAGATGAAGAGCACCAACTC) and (TRCN0000158395; CCTACAGTGGATGTCCTACAT) (Sigma Aldrich). The transduced cells were selected in media containing 1 ug/ml puromycin for 6 days ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control siRNA and siRNAs for ZNF704 were synthesized by Sigma-Aldrich. The siRNA oligonucleotides were transfected into cells using RNAiMAX with a final concentration of 20 nM.
-
bioRxiv - Cancer Biology 2020Quote: ... Control cells were treated with equivalent concentrations of DMSO (Sigma-Aldrich). Several first passage aliquots of each cell line were stored in liquid nitrogen for subsequent assays.
-
bioRxiv - Cell Biology 2021Quote: ... Control and shRNA lentiviruses were purchased from Sigma-Aldrich (Table S3). Viral particles were added at a multiplicity of infection of 1 ...
-
bioRxiv - Microbiology 2020Quote: ... and positive controls were chloramphenicol (8and 4 µg/mL) (Sigma-Aldrich) for planktonic cells and dispersin B (50and 5 µg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... as a control and with the PTEN inhibitor VO-OHpic24 (Sigma) at 50 nM ...
-
bioRxiv - Cancer Biology 2020Quote: ... controls pLKO (SHC001, no insert) and non-mammalian shRNA (Sigma; SCH002) in 293T cells using the third-generation lentiviral packaging system (10,11) ...
-
bioRxiv - Cell Biology 2020Quote: ... control cells were treated with vehicle alone (DMSO, from Sigma-Aldrich) at the corresponding concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... Control and shRNA lentiviruses were purchased from Sigma-Aldrich (Table S2). Viral particles were added at a multiplicity of infection of 1 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the CRISPR-lenti lentiviral vector Non-directed control plasmid (Sigma-Aldrich) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... GSK3β inhibitor) and methyl-BIO (MBIO, control) were obtained from Millipore, and a 10 mM stock solution was prepared in DMSO ...
-
bioRxiv - Neuroscience 2023Quote: ... [37] or 100 μl sesame oil (S3547, Sigma-Aldrich, vehicle control). Testosterone administration was calculated to obtain supraphysiological testosterone levels concomitant with those observed in female IIH patients [33 ...
-
bioRxiv - Neuroscience 2023Quote: ... randomly assigned to either control or ouabain group (2 mM, Sigma, O3125 ...
-
bioRxiv - Neuroscience 2023Quote: ... randomly assigned to either control or bumetanide group (20 μM, Sigma, B3023 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The positive control consisted of 100 mM camostat mesylate (Sigma Aldrich), a known TMPRSS2 inhibitor ...
-
bioRxiv - Molecular Biology 2022Quote: ... and DMSO-only vehicle controls (1:1000, Sigma cat no. D4540).
-
bioRxiv - Genetics 2024Quote: ... CHX controls were treated with 2 mg/ml CHX (Sigma #1810) added 6 hours prior to harvest ...
-
bioRxiv - Molecular Biology 2024Quote: ... MISSION® siRNA Universal Negative Control (Sigma-Aldrich; catalog no. SIC001), was used in our experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... loading control GAPDH was ran at a 1:5,000 dilution (MilliPore), with HRP-conjugated anti-mouse secondary at 1:5,000 dilution (Southern Biotech) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Control organoids were treated with equal volume of DMSO (Sigma, D8418). Images were taken on a Keyence BZ-X810 microscope.
-
bioRxiv - Developmental Biology 2023Quote: ... Control embryos were treated with dimethyl sulfoxide (DMSO; Sigma-Aldrich D2650) only.
-
bioRxiv - Biophysics 2023Quote: ... DMSO was used as a control at 0.3% (Sigma-Aldrich 472301).
-
bioRxiv - Bioengineering 2023Quote: ... Positive control was treated with 2% Triton X-100 (Sigma Aldrich). Calculations were given as a percentage of control.
-
bioRxiv - Cell Biology 2023Quote: ... and the negative controls IgG-rabbit (Sigma-Aldrich; #I5006; 4 μg) or IgG-mouse (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... Positive control cells were treated with hydroxyurea (HU) (100 µM) (Sigma) or methyl methanesulfonate (MMS ...
-
bioRxiv - Immunology 2023Quote: ... Positive controls were conducted by adding 10 ng/mL PMA (Sigma) plus 1 µg/mL ionomycin (Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... Control mice received 250µg of IgG from rat serum (Sigma, 18015) i.p ...
-
bioRxiv - Molecular Biology 2023Quote: ... THP1 cells were transfected with control or Dll4 siRNA (Sigma-Aldrich) at 10 µM by Lipofectamine™ RNAiMAX (#13778 ...
-
bioRxiv - Cancer Biology 2023Quote: MISSION pLKO.1-puro-shRNAs-Vectors for Control (Sigma-Aldrich, #TRCN0000382379), LSD2 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... non-targeting shRNA control (shCtrl: SHC016) were purchased from Sigma-Aldrich. Tetracyclin (Tet ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-Cell cycle control protein 50A (anti-CDC50A/TMEM30A, Sigma, AV47410), anti-Microtubule-associated protein 1 light chain B (anti-MAPLC3/LC3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Control immunoprecipitation was performed using purified preimmune rabbit IgG (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2023Quote: ... or vinculin (VCL) as loading control (1:40,000; #V9131, Sigma-Aldrich) overnight at 4°C followed by horseradish peroxidase-conjugated secondary IgG antibody (Bio-Rad Laboratories ...
-
bioRxiv - Immunology 2024Quote: ... Control cells were cultured with cycloheximide (100 µg/mL, Sigma-Aldrich) for 20 min prior to addition of OPP to assess background staining level when cytosolic protein synthesis is completely inhibited ...
-
bioRxiv - Molecular Biology 2024Quote: ... Mission SHC002 non-mammalian shRNA was used as control (Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... and solvent control [1% DMSO + 3% Kolliphor EL (Sigma-Aldrich, #C5135) + 96% PBS] was administered by intraperitoneal injection at 10 mg/kg/day for 4 weeks starting on the day of tumor initiation.
-
bioRxiv - Biochemistry 2021Quote: ... primary antibodies followed by anti-mouse (#A4416) and anti-rabbit (#A0545) secondary antibodies conjugated to horseradish peroxidase (both are from Millipore-Sigma and used at 1:10,000). WesternBright Sirius chemiluminescent horseradish peroxidase substrate (Advansta ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibody incubation was performed at room temperature for 45min (Monoclonal ANTI-FLAG® M2 antibody produced in mouse Millipore-Sigma F1804 at 1/250 dilution), followed by three 5 min washes in 1X PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibody incubation was performed at room temperature for 45min (Monoclonal ANTI-FLAG® M2 antibody produced in mouse Millipore-Sigma F1804 at 1/250 dilution), followed by three 5 min washes in 1X PBS ...
-
bioRxiv - Bioengineering 2020Quote: ... co-staining was performed using rabbit anti-perilipin A antibody as an adipocyte marker in combination with a mouse anti-human mitochondria (hMito) antibody conjugated with Cy3 (EMD Millipore, Burlington, USA; 1:100 dilution). hMito was used as an alternative to Ku80 based on the availability of antibodies compatible for co-staining ...
-
bioRxiv - Cancer Biology 2021Quote: ... The blot was then incubated with a polyclonal anti-AE2 C-terminal antibody (anti-AE2Ct) or the mouse monoclonal anti α-tubulin antibody (Sigma Aldrich, St. Louis, MO, USA) in TBS-Tween 20 + 0.1% BSA ...
-
bioRxiv - Cancer Biology 2019Quote: ... polymerase (PARP)-1 polyclonal antibody (1:1000; Epitomics, Burlingame, CA, USA) and a mouse anti-β-actin antibody (1:10000; Sigma-Aldrich, St. Louis, MO, USA), followed by incubation with secondary antibodies and chemiluminescence detection.
-
bioRxiv - Systems Biology 2020Quote: ... Alpha and beta pancreatic cells were evaluated in dewaxed sections using specific primary antibodies (mouse monoclonal anti-Glucagon and anti-Insulin antibodies, Sigma-Aldrich Corp., St. Louis, Mo. USA). Rabbit polyclonal antibodies against PDX1 ...