Labshake search
Citations for Millipore Sigma :
3151 - 3200 of 10000+ citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... strains containing a degron tag were arrested at 30 °C for 3 hours (total) and then treated with 250 μM 3-indole acetic acid (Sigma-Alrich, St. Louis, MO) for 30 minutes before harvesting ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Biophysics 2023Quote: 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) and 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) dry powders were purchased from Sigma Aldrich (St. Louis, MO, USA). Different amounts of DOPC and DOTAP were used to tune the surface charge of the employed liposomes ...
-
bioRxiv - Biophysics 2023Quote: ... the quench buffer also included 3 μL of 0.8% GDN and 3 μL of 300 mg/ml aqueous suspension of ZrO2-coated silica (Sigma-Aldrich, reference no. 55261-U). The resulting mixture was incubated on ice for 1 min to remove lipids and solubilize prestin in GDN before being filtered through a cellulose acetate spin cup (Thermo Pierce ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... for 3 h followed by ATP (2 mM, Sigma Aldrich, A6419-5g ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit polyclonal anti-PCSK1 (PC1/3) (1:1000, Sigma, #SAB1100415), rabbit polyclonal anti-TSSC1/EIPR1 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 200 μM 3-isobutyl-1-methylxanthine (IBMX; Sigma), and their cumulus cells were removed by gentle pipetting ...
-
bioRxiv - Cell Biology 2020Quote: ... 250 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich # I5879), 1 μM rosiglitazone (Cayman Chemical # 71742) ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were blocked and simultaneously permeabilized with 3% BSA (SIGMA) and 0.2% Triton X-100 (SIGMA ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were subsequently blocked and permeabilized with 3% BSA (SIGMA) and 0.2 w/v % Saponin (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... or 3 µg/cm2 poly-L-lysine (Sigma-Aldrich, P6407) overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x Phosphatase inhibitor cocktail 2 and 3 from Sigma-Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... and then blocked with 3% (w/v) BSA (Sigma-Aldrich) and 0.05% (v/v ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-15 µM MG132 (Z-Leu-Leu-Leu-al, Sigma) was added to the media for the indicated hours prior to cell lysis/fixation ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Caspase-3 antibody (Sigma USA, Dubey and Tapadia, 2017) was used at a dilution of 1:100 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 30 μL D2O with 3%TPS (Sigma Aldrich, 450510) and transferred in a standard 5 mm NMR tube (Wilmad-LabGlass ...
-
bioRxiv - Neuroscience 2022Quote: ... propyl acetate and 3-methyl-2-buten-1-ol (Sigma). Odorants were selected based on previous work using this task (Gu & Li ...
-
bioRxiv - Biophysics 2022Quote: ... 250 μM 3-isobutyl-1-me-thylxantine IBMX (Sigma-Aldrich), 100nM cortisol (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 1X Phosphatase inhibitor cocktails 2 and 3 (Sigma P5726, P0044), and 1X Protease inhibitor tablets (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and dispase-II (3 mg/mL, Cat# D4693, Sigma-Aldrich) for 60 min at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-Partitioning-defective 3 (Par3) (Sigma, 07-330, 1:1000), anti-Parvin (Cell signaling ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated for 3 days in JB-4 (Sigma)/Eosin (Sigma)/Acridine orange (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... DL-Serine Hydroxymate (SHX, Sigma CAS Number 55779-32-3), an inhibitor of seryl-tRNA synthetase which triggers the stringent response and prevents new rounds of replication ...
-
bioRxiv - Bioengineering 2022Quote: ... 121 mg of N-(3-Dimethylaminopropyl)-N’-ethylcarbodiimide ( EDC) (Sigma) and 28 mg of RGD peptide ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3:1 mixture of random hexamers/OligodT (Sigma-Aldrich), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μL of 1 mg/mL RNase A (Sigma R6148) and 3 μL of 20 mg/mL Proteinase K (NEB EO0491 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% murine plasma and 10 mM HEPES (Sigma) and left to settle for 45 minutes in the incubator at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Phostphatase Inhibitor Cocktail 3 (Sigma-Aldrich; St. Louis, MO, USA) 1x TBS ...
-
bioRxiv - Biophysics 2019Quote: ... then bound proteins were eluted with 3 mM desthiobiotin (Sigma) or 50 mM D-biotin (CHEM-IMPEX ...
-
bioRxiv - Neuroscience 2019Quote: ... the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich, Ref. #TRCN0000012392) or the shRNA control (dsRed2 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and Phosphatase Inhibitor Cocktail no.2 and no.3 (Sigma). Following manufactures recommendations ...
-
bioRxiv - Physiology 2019Quote: ... and 100 μM 3-isobutyl-1-methylxanthine (IBMX, Sigma-Aldrich) was added to elicit a maximal cAMP response ...
-
bioRxiv - Immunology 2019Quote: ... and incubated in blocking buffer (3% BSA (#A7906, Sigma, USA) in PBS supplemented with 0.1% Triton X-100 (#9002-93-1 ...
-
bioRxiv - Bioengineering 2019Quote: ... 2 mM of HCL (Millipore Sigma, cat no. HX0603-3), and 0.5 mM of iron (II ...
-
bioRxiv - Immunology 2019Quote: The macrophages were activated by 3 μg/mL LPS (Sigma) and 100 pmol IFN-γ for 6 hrs ...
-
bioRxiv - Physiology 2020Quote: ... containing 3% (w:v) bovine serum albumin (BSA) (Sigma Aldrich, Australia), 1 mg/ml Type 2 Collagenase (Sigma Aldrich ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Immunology 2019Quote: ... followed by blocking of endogenous peroxidase with 3% H2O2 (Sigma H-1009 ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 mg/L indole-3-acetic acid (Sigma-Aldrich, USA), 1 mg/L zeatin-riboside (Sigma-Aldrich ...
-
bioRxiv - Genetics 2019Quote: ... 0.1 mg/ml 3-sn-Phosphatidic acid sodium salt (Sigma) respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Genejuice (EMD Millipore) and 1 μg plasmid DNA ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 mM 5-phosphoribosyl 1-pyrophosphate (PRPP Sigma-Aldrich P8296), 2 mM ATP ...
-
bioRxiv - Genomics 2019Quote: ... and 0.25 mM (days 3-10) ascorbic acid (Sigma-Aldrich).
-
bioRxiv - Bioengineering 2019Quote: ... and (3-aminopropyl)trimethoxysilane (24 mL) (APTMS 97%, Sigma-Aldrich). The mixture was incubated in an oil bath at 40 °C with magnetic stirring at 400 rpm for 16 h ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by addition of 3 mL ethylene glycol (Sigma-Aldrich) to remove unreacted sodium periodate ...
-
bioRxiv - Immunology 2019Quote: ... After 3 minutes 200μl of 0.5% Evans Blue dye (Sigma) was injected into the tail vein ...