Labshake search
Citations for Millipore Sigma :
3101 - 3150 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Cell Biology 2023Quote: ... Dried extracts were phase-separated using -20°C LCMS-grade chloroform/methanol/water (1:3:3, v/v) (Sigma Aldrich).
-
bioRxiv - Plant Biology 2023Quote: Leaf disks (3 mm) of Arabidopsis thaliana and Nicotiana benthamiana were fixed with 3% (w/v) glutaraldehyde (Sigma, Taufkirchen, Germany) in 0.1 M sodium cacodylate buffer (SCB ...
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Neuroscience 2023Quote: ... were placed in the middle of a 2% agar plate containing a container with 10 µl n-amylacetate (AM, diluted 1:50 in mineral oil; SAFC) or 3-Octanol (3-Oct, Sigma) on one side and a blank on the other side ...
-
bioRxiv - Plant Biology 2023Quote: The auto activity of yeast baits on Sc-His due to minimal HIS3 expression was determined by spotting them on Sc-His media containing 0-30 mM 3-Amino-1,2,4-triazole (3-AT) (A8056, Sigma-Aldrich, USA). The minimum concentration of 3-AT that completely inhibits the growth of the bait was considered for the Y1H assay (20mM for pdistal ...
-
bioRxiv - Molecular Biology 2023Quote: ... were cleaned by sonication with 3 M NaOH then Piranha solution (2:3 ratio of 30% (w/w) H2O2 to sulfuric acid) and treated with 3-glycidyloxypropyl trimethoxysilane (GOPTS) (Sigma). GOPTS was then reacted with a mixture of 9 parts α-hydroxy-ω-amino PEG 3000 to 1 part α-biotinyl-ω-amino PEG 3000 by weight (Rapp Polymere) ...
-
bioRxiv - Bioengineering 2023Quote: ... d(AA)-3’ and antisense strand: 5’-r(UUU GCC AUG GCA GAA AUA GGC) d(TT)-3’ were purchased from Sigma–Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... organoids were treated four days after ex vivo Hsp60 deletion with the Ido1 agonist 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich) or the Ido1 antagonist dimethyltryptamine (1-D-MT ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Lysate samples were MWCO filtered using 3 kDa and 10 kDa Amicon filters (Merck Millipore, catalog no.: UFC500308 (3 kDa), UFC501008 (10 kDa) ...
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by the reaction of Fe3+ with the xylenol orange dye (o-cresolsulfonephthalein 3′,3″-bis[methylimino] diacetic acid, sodium salt; Sigma). Ten seeds were placed in each well of 12-well plates containing 2 mL of liquid MS/2 medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... OVCAR-3 and SK-OV-3 cells were treated with the dicarbonyl stress-inducing compound methylglyoxal (MG) (M0252, Sigma-Aldrich) for 48-72 h.
-
bioRxiv - Plant Biology 2021Quote: ... 20 μl 40 mM glucose-6-phosphate (Sigma-Aldrich, now Merck KGaA) and 20 μl 35 mM NADP+ (KMF OptiChem ...
-
bioRxiv - Cell Biology 2020Quote: Primary antibodies used: Antibody anti-acetylated tubulin (clone 6-11B-1, Sigma), α-tubulin (Biorad MCA77G) ...
-
bioRxiv - Cell Biology 2020Quote: Antibody anti-acetylated tubulin (clone 6-11B-1, mouse monoclonal, Sigma Aldrich), anti-Poly-Glu tubulin (1:1000 ...
-
bioRxiv - Immunology 2021Quote: ... DNA was counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). NETs were visualized by using an Olympus IX81 motorized epifluorescence microscope (Olympus America Inc. ...
-
bioRxiv - Immunology 2021Quote: ... Dried lipids were then combined with 5(6)-carboxyfluorescein (CF) (Sigma #21877) and vortexed for 5 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Pictures were acquired using a FSL confocal microscope (Olympus).
-
bioRxiv - Molecular Biology 2020Quote: ... 250 μl of washing buffer supplemented with 6 mM free biotin (Sigma) was added to the beads ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbi-anti-Zwf1 (Glucose-6-phosphate dehydrogenase; Sigma A9521; at 1:10,000) overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidine-2’-phenylinedole dihydrochloride (DAPI) were purchased from Sigma (MO, USA). The primary antibody raised against DMT1 was purchased from Santa Cruz Biotechnology (CA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5min room temperature incubation in 0.1N NaOH (Sigma-Aldrich, Inc., SX0607N-6), another TE-TW wash ...
-
bioRxiv - Immunology 2019Quote: 6-diazo-5-oxo-l-norleucine (DON) was purchased from Sigma-Aldrich. JHU083 (Ethyl 2-(2-Amino-4-methylpentanamido)-DON ...
-
bioRxiv - Immunology 2020Quote: ... Nuclei were counterstained with 4’,6’-Diamidino-2-phenylindole (DAPI; #D9564; Sigma) diluted 1/1500 in PBS/Ca/Mg for 5min ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were cultured in 6-well plates and 20µM siRNA oligonucleotides (Sigma, SASI_Hs01_0086240 for AKTIP ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Imaging of cells was carried out in epifluorescence and differential interference contrast (DIC ...
-
bioRxiv - Physiology 2019Quote: ... DAPI (4’,6-diamidino-2-phenylidole, 1 μg/mL, Sigma-Aldrich, Israel) was added followed by fluorshield (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2019Quote: For DAPI staining (4′,6-diamidino-2-phenylindole; Sigma, St. Louis, MO), transfected leaf discs were cut and placed in DI water with 5 µg/ml DAPI for 30 min prior to mounting in DI water for imaging ...
-
bioRxiv - Immunology 2019Quote: ... mice were gavaged with 300 ul of 6% carmine red (Sigma-Aldrich) suspended in 0.5% methylcellulose (Wako) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and Trolox (6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; 1 mM; Sigma). PCA and PCD constitute an oxygen-scavenging system and Trolox functions as a triplet-state quencher to improve fluorophore performance.
-
bioRxiv - Genomics 2021Quote: ... complexed with 6 mg pre-swollen protein A Sepharose beads (Sigma-Aldrich) during a 2-h incubation at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... Cell nuclei were stained with 4’,6-diamidino-2-Phenylindole (DAPI) (Sigma) to visualize cell layers and borders of the DCN and VCN ...
-
bioRxiv - Neuroscience 2020Quote: 8-(tri-fluoromethyl)-1,2,3,4,5-benzopentathiepin-6-amine hydrochloride (TC-2153 (Sigma-Aldrich)) or vehicle (5% DMSO in saline ...
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; Sigma-Aldrich, North Ryde, NSW, Australia) was used for nuclear staining of the neurons.
-
bioRxiv - Cell Biology 2021Quote: ... postfixed in 2% OsO4 and 1.5% K4 Fe(CN)6(Sigma-Aldrich) in 0.1 M sodium cacodylate buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were visualized with 4’,6-diamidino-2-phenylindole (DAPI, blue; Sigma) staining ...
-
bioRxiv - Microbiology 2021Quote: ... samples were labeled with DAPI (4, 6-diamidino-2-phenylindole; Sigma-Aldrich) for 10 minutes at room temperature following fixation ...
-
bioRxiv - Bioengineering 2020Quote: ... 0.84 v% chondroitin-6-sulfate sodium salt from shark cartilage (Sigma Aldrich), and additional calcium nitrate tetrahydrate (Sigma Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... Nuclear staining was performed using 4’,6-diamidino-2-phenylindole dihydrochloride (Sigma). Then ...
-
bioRxiv - Genetics 2021Quote: ... Deparaffinized 6 μm sections were stained in 1% Alcian Blue (Sigma, #MKCM1030) for 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... labeling of nuclei using 4’,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich) or ToPro3 (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: Adult zebrafish (6 months old) were anaesthetized in 0.016% tricaine (Sigma, MS222), and a spinal cord crush injury was performed according to a previously described method (Fang et al. ...
-
bioRxiv - Physiology 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, #D9542) was purchased from Sigma-Aldrich Co ...
-
bioRxiv - Microbiology 2021Quote: The washed beads were resuspended in 500 μL 6 M urea (Sigma) in PBS and incubated with 10 mM DTT (GoldBio ...
-
bioRxiv - Microbiology 2019Quote: ... 18.65 ± 0.49 mM xylose (Sigma-Aldrich, cas # 58-86-6, 99% purity) or 0.56 ± 0.02 mM L-citrulline (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... then counter stained with 4’,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich). Images were taken using an Olympus FV1000 confocal microscope (Tokyo ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM potassium ferrocyanide [K4Fe(CN)6·3H20] (Sigma cat. # P-9287), 5 mM potassium ferricyanide [K3Fe(CN)6] (Sigma cat ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and incubated with 7 mL of 6 ppm CdCl2 (Sigma Aldrich 202908) in ddH2O for 90 min on an orbital shaker ...
-
bioRxiv - Cell Biology 2022Quote: ... and DAPI (4’,6-diamino-2-phenylindole) (D9542; Sigma; 1 μg/mL). Additionally ...