Labshake search
Citations for Millipore Sigma :
3001 - 3050 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... in 6-well dishes over SCM media (1x MEM (Millipore-Sigma), 1x GLUTAMAX (Gibco Thermo-Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... in 6-well dishes over SCM media (1x MEM (Millipore-Sigma), 1x GLUTAMAX (Gibco Thermo-Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... Nuclei were stained with 4-6-diamidino-2-phenylindole (DAPI, Sigma).
-
bioRxiv - Immunology 2023Quote: ... for 6 hours or 20 μM nigericin (Sigma-Aldrich#N7143-5MG) for 30 mins ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Sigma). Glass cover slips were mounted in ImmunoMount (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM K4[Fe(CN)6]·3H2O (P-3289, Sigma-Aldrich), and 2 mM MgCl2 (M-8266 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 30 μM 6-thioguanine (Sigma-Aldrich, A4882) in NaOH (stock solution 30mM 6-thioguanine in 1M NaOH ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1:1000; Sigma-Aldrich) at room temperature for 2 hours ...
-
bioRxiv - Microbiology 2023Quote: ... The pellet was re-dissolved in 6 M Urea (Sigma Aldrich) in 200 mM ammonium bicarbonate ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µL 10 mM Biotin-Azide (Sigma-Aldrich, dissolved in DMSO) and 10 µL 100 mM Sodium Ascorbate (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... mice were initially administered 100mg/kg 6-OHDA (Sigma-Aldrich #162657) for one continuous week ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (l mg/mL, Sigma Aldrich, Schnelldorf, Germany) for 5 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... cells were selected in 6 μg/mL of puromycin (Sigma, P8833) or 7 μg/mL blasticidin (Research Product International ...
-
bioRxiv - Bioengineering 2023Quote: ... and 6 µl 10% (m/v) Ammonium Persulfate (A3678, Sigma-Aldrich) in dH2O were also added to AAm and Bis-AAm solution ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were then washed twice with 100% methanol (Sigma, MX0480-6), followed by twice with 100% ethanol (Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid; Sigma #238813-1G) was dissolved in 3.2 mL of HPLC grade water ...
-
bioRxiv - Cell Biology 2023Quote: ... SSC (side scatter) and DAPI (4’,6-diamino-2-phenylindole; Sigma). FACS analyses were carried out using BD LSRII flow cytometry (BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... 10% POPG) filled with 50 mM 5(6)-Carboxyfluorescein dye (Sigma) were prepared as previously described29 ...
-
bioRxiv - Developmental Biology 2023Quote: ... DAPI (4”, 6-diamidino-2-phenylindole; Sigma, cat. no. D-9542) was used at 1 ug/ml to reveal nuclei ...
-
bioRxiv - Immunology 2023Quote: ... Mouse Monoclonal anti-mouse Glutamin Synthetase (GS-6, 1:250, Millipore), Rabbit Polyclonal anti-SDS (PA5-58704) ...
-
bioRxiv - Cell Biology 2023Quote: ... monoclonal mouse acetylated tubulin (clone 6-11B-1, Sigma; 1:1000), polyclonal rabbit alpha tubulin (Abcam ...
-
bioRxiv - Plant Biology 2023Quote: ... 32 pmol M13-labeled 6-FAM fluorescent dye (Sigma Life Science), 8 pmol M13-labeled forward primer and 32 pmol reverse primer (Sigma Life Science) ...
-
bioRxiv - Cell Biology 2023Quote: Kinase inhibitors used are CDK4/6 inhibitor (PD 0332991, Palbociclib, Sigma); MEK/ERK inhibitor U0126 (Calbiochem) ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; D9542-10MG, 1:10000; Sigma-Aldrich) in PBS for 20 minutes ...
-
bioRxiv - Physiology 2024Quote: ... NRVMs were plated in 6-well plates precoated with gelatin (Sigma) at 0.8x105 cells per well and cultured in NRVM medium (DMEM supplemented with 5% FBS and 10% horse serum ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... supplemented with 6% ES cell media (ES-101B, Sigma, Louis MO), 15% fetal calf serum (Millipore) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diazo-5-oxo-L-norleucine (DON, Sigma, cat no. D2141); and CB-839 (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... acetylated tubulin (1:10000, clone 6-11B-1, T6793, Sigma-Aldrich) or α-tubulin (1:1000 ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstained with 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Sigma-Aldrich) and mounted on slides with VECTASHIELD antifade Mounting Medium (Vector Laboratories ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI dihydrochloride; Merck Sigma-Aldrich), respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI; D9542-10MG, 1:10000; Sigma-Aldrich) in PBS for 20 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3×FLAG::GFP-tagged protein and associated RNAs were eluted with 100 μg/mL 3×FLAG peptide (Sigma). The eluates were incubated with TRIzol reagent (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... and murine interleukin 3 (IL3)-producing WEHI-3 cells were cultured in Dulbecco’s modified Eagle medium (DMEM, Sigma-Aldrich) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2022Quote: ... and then crosslinked with carbodiimide chemistry in PBS solution:1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Sigma-Aldrich) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Plant Biology 2019Quote: ... Labeled standards for indole-3-acetic acid and N-(3-indolylacetyl)-DL-aspartic acid were obtained from Sigma-Aldrich. Calibration curves were linear (r values = >0.99 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were further washed with TBS and treated with DAB solution for 20 minutes (0.025% 3, 3’-diaminobenzidine tetrahydrochloride; Sigma + 2.5% Nickel Sulphate Hexahydrate ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were resolved on the Discovery HS F5-3 column (2.1 mmI.D. x 150 mmL, 3 μm particle, Sigma-Aldrich), using a step gradient with mobile phase A (0.1% formate ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biophysics 2022Quote: 1,2-dioleoyl-sn-glycero-3-phosphocoline (DOPC) (TebuBio) and 1,2-dioleoyl-sn-glycero-3-phospho(1’-rac-glycerol) (sodium salt) (DOPG) (Sigma) were dissolved in chloroform ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 3×106 co-transformants was initially screened for growth on synthetic defined media (SD)-Leu-/ Trp-/ Ura-/ His- media containing 20mM of 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich). Plasmids were isolated from the potential positive colonies ...
-
bioRxiv - Cell Biology 2022Quote: ... the sections were immersed in a solution of 0.05% 3-3’diaminobenzidine-4HCl (DAB, Sigma-Aldrich, St Louis, MO) and 0.05% hydrogen peroxide ...
-
bioRxiv - Immunology 2020Quote: The following reagents were used in this study: 3-methyladenine (3-MA; M9281; Sigma-Aldrich, St. Louis, MO, USA), dimethylsulfoxide (D2650 ...
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Molecular Biology 2022Quote: ... fungal hyphae grown (for 2-3 weeks) in liquid M-C medium without Fe were exposed 3 days to 0.5 mM ferrozine (Sigma). This was done by replacing the liquid medium by 20 ml of a freshly prepared liquid M-C medium without Fe and supplemented with 0.5 mM ferrozine ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... paws were incubated twice for 5min with methanol 50% BABB (1/3 benzylalcohol and 2/3 benzylbenzoate, from Sigma), and then three times in pure BABB for 5min each (or until the sample is cleared) ...
-
bioRxiv - Cancer Biology 2019Quote: CT26 cells that had been stably transduced with PCK1-targetting shRNA hairpins or control hairpins were grown in vitro for 3 days and counted on day 3 using the Sceptor 2.0 automated Cell counter (Millipore).
-
bioRxiv - Microbiology 2021Quote: ... harvested at day 3 and clarified by centrifugation at 350 x g for 15 minutes (Sigma 3-16K centrifuge). Viral stocks were concentrated by centrifugation at 11 ...