Labshake search
Citations for Millipore Sigma :
3051 - 3100 of 10000+ citations for PGFM ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Cohort 2: 10 (5 male and 5 female) received a single daily injection of BrdU (150 mg/kg, i.p.; Sigma B5002) on days 6 – 8 after infusion and 3 injections of EdU on day 21 after lentivirus injection ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 mice (5 male and 5 female) received a single daily injection of BrdU (150 mg/kg, i.p.; Sigma B5002) 1 month after infusion ...
-
bioRxiv - Cell Biology 2022Quote: ... All samples with SDS sample buffer were heated at 95°C for 5 minutes and reduced with 5% 2-mercaptoethanol (Sigma) as needed.
-
bioRxiv - Neuroscience 2024Quote: ... Sections were rinsed in water three times before a 5 min bath of 5% Sodium Thiosulfate (Sigma Aldrich, catalog #S7026).
-
bioRxiv - Molecular Biology 2023Quote: ... the following doses of chemicals and genotoxic agents were used: 5-Aza-2’-deoxycytidine (5-AzadC; 10 μM, Sigma-Aldrich), 5-Ethynyl-2’-deoxyuridine (EdU ...
-
bioRxiv - Cancer Biology 2024Quote: ... the cultures were washed in cold PBS then the cells were scrape harvested in 300 μL 5% 5-sulfosalicylic acid (Sigma) in water and stored at -20°C for a maximum of 72 hours ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Biophysics 2024Quote: ... the blots were blocked with Tris-buffered saline with 0.1% Tween-20 detergent (TBST) + 5% milk and probed using TBST + 5% milk with anti-FLAG (ANTI-FLAG(R) M2-Peroxidase (HRP) by Sigma) or anti-His6X (His HRP conjugate by Qiagen ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 nM siRNA against DDX3X (5’-CCUAGACCUGAACUCUUCAGAUAAU dTdT-3’) or 20 nM siRNA against GRSF1 (5’-GUGCCUCUCUGCUGCCGCAdTdT-3’) which were synthesized by Sigma. Cells were subsequently incubated at 37 °C for 48 h before harvesting and analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... rapamycin was diluted in a vehicle solution that contained 5% Tween 80 and 5% PEG 400 (low-molecular-weight grade of polyethylene glycol; Sigma) and injected intraperitoneally (i.p. ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then dehydrated by 2x 5 min 100% ethanol washes and cleared with xylol (2 x 5 mins) before mounting with Entellan (Sigma).
-
bioRxiv - Physiology 2023Quote: ... Samples were blocked for three hours at room temperature in blocking solution [5% normal goat serum (MP Biochemicals) plus 5% bovine serum albumin (Sigma) in PBST] and then incubated overnight at 4°C in primary antibodies diluted in blocking solution ...
-
bioRxiv - Neuroscience 2022Quote: ... or DMSO 0.1% as vehicle was evaluated using a MTT (3-(4, 5-dimethylthiazol-2-yl)-2-5-diphenyltetrazolium bromide) (Sigma-Aldrich) assay as described in (Sanz et al. ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... was PCR amplified from cDNA clone AV639302 (Kazusa) with oligos 5’-GCCAGGATCCGGAGAATTTATACTTCCAGGGTGCTACCCCCGTGCCCAAG-3’ and 5’-CGCGCGAAGCTTTTACGAGAGCTGGGCCAGG-3’ and cloned with BamHI and HindIII into petDUET (Novagen), giving pFW21 ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... primary and secondary antibody incubations were done in TBS-T (Roth, 1061.1) supplemented with 5% milk powder (Heirler, 4010318030305) or 5% BSA (Sigma, A7906). Blots were blocked for 1h at RT and primary antibody was added over night at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Designed primers included standard FAM or HEX compatible tails (FAM tail: 5’ GAAGGTGACCAAGTTCAT-GCT 3’; HEX tail: 5’ GAAGGTCGGAGTCAACGGATT 3’ (Sigma)) Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were denatured for 5 min at 95 °C in Bolt LDS Sample buffer with 5 % v/v 2-mercaptoethanol (Sigma). 10-30 μg of proteins were loaded in Bolt 4-12 % Bis-Tris gels (Thermo ...
-
bioRxiv - Biophysics 2023Quote: ... 10 µL of the lipid solution was added to 89.5 µL H2O containing NaCl and 0.5 µL of a 5% solids solution of 2 µm silica microparticles (Sigma Aldrich) to a final concentration of 0.1 mM lipids and 1 mM NaCl ...
-
bioRxiv - Immunology 2023Quote: ... Sections were developed for 5 min in DAB solution (3,3’diaminobenzidine; 5 mg/ml DAB, 0.1M PB, 0.000036% H2O2; Sigma-Aldrich D-5637). Acute neuronal loss in the CA1 region of the hippocampus was quantified as described previously2.
-
bioRxiv - Cell Biology 2023Quote: ... AID Full Length F 5’-CCCAAGCTTATGGGCAGTGTCGAGCTG-3’ AID 1-114 F 5’-CCCAAGCTTATGGCAGTGTCGAGCTGAATC-3’ AID 31-114 F 5’-CCCAAGCTTAGAGGGTTCTCAGAGACGGTTG-3’ AID 71-114 F 5’-CCCAAGCTTAAAGATCCAGCCAAACCTCC-3’ AID R 5’-AAGGAAAAAAGCGGCCGCTACCTTCACGAACG-3’ PCR products were cloned into p3xFLAG-CMV10-PP6c construct (Sigma) using restriction digests and sequence confirmed ...
-
bioRxiv - Microbiology 2023Quote: ... Ultrathin sections of 50 nm were blocked with 5% fetal bovine serum/5% normal goat serum for 30 min and subsequently incubated with rabbit anti-HA antibody (Sigma) for 60 min at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... were mixed with ssDNA output oligonucleotides of interest at 2x excess (Table S1) in 1x annealing buffer (5 mM Tris, 1 mM EDTA, 5 mM MgCl, Millipore, cat# 648311-1KG ...
-
bioRxiv - Molecular Biology 2023Quote: ... ascending aorta of 10 animals (TBAV: n=5; HTAV: n=5) were incubated in 4,5-diaminofluorescein diacetate (DAF-2DA; Sigma-Aldrich) as previously described20 ...
-
bioRxiv - Bioengineering 2023Quote: ... The gels were then washed with wash buffer three times for 5 min followed by permeabilization and blocking in 5% BSA (Sigma), 1% Triton X-100 (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatant (5 μl) was injected onto a ZIC-pHILIC 150 × 2.1 mm (5-μm particle size) column (EMD Millipore) connected to a Thermo Vanquish ultrahigh-pressure liquid chromatography (UPLC ...
-
bioRxiv - Neuroscience 2023Quote: mice received an intraplantar injection of 20 μl of 5% formalin diluted from formaldehyde solution (5% v/v from 37% stock formaldehyde solution (Sigma)) in sterile saline ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were blocked using 5% BSA or 5% non-fat dried milk in TBS containing 0.05% Tween 20 (Sigma-Aldrich) for 1h at 15-25°C ...
-
bioRxiv - Immunology 2023Quote: ... B cells (seeded at 5 x 105 / mL) were cultured with 5 µg/mL LPS (Sigma-Aldrich, St Louis, MO), 10 ng/mL BAFF (AdipoGen ...
-
bioRxiv - Genomics 2023Quote: ... with 3 mL of cell culture media added to each well and treated with 5 µM 5-azacytidine (A2385, Sigma), 10 µM dexamethasone (D1756 ...
-
bioRxiv - Biophysics 2023Quote: ... dissolved in Tris buffer (5 mM TRIS, 5 mM NaCl, 20 mM MgCl2, pH 7.5 (all chemicals from Sigma-Aldrich)
-
bioRxiv - Immunology 2023Quote: ... Single-cell suspensions (some of which were pooled from tumors harvested from 2-3 mice) were stimulated for 5 h with PMA (5 ng/ml, Sigma) and ionomycin (500 ng/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice treated with chronic rapamycin for 5 weeks also received a daily 5 mg/kg dose of rapamycin (Sigma-Aldrich) I.P ...
-
bioRxiv - Cancer Biology 2024Quote: Previously cryopreserved hPBMCs were cultured overnight at 37 °C and 5% CO2 in T cell media (RPMI-1640 supplemented with 5% heat-inactivated FBS (Sigma), 100 U/mL penicillin ...
-
bioRxiv - Cell Biology 2024Quote: ... Arteries were then stimulated with increasing concentrations of serotonin (5-HT, from 10–8 to 3·10–5 M, Sigma), endothelium-dependent vasodilator acetylcholine (ACh ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4T1 cell lines were provided by WSU Animal Model and Therapeutics Evaluation Core (AMTEC) and were grown in 5% CO2 using DMEM supplemented with 1% penicillin-streptomycin and 5% fetal bovine serum (Sigma) as media at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Serum insulin and c-peptide levels were measured by insulin or C-peptide ELISA respectively following the manufacture’s protocol (Sigma Aldrich, St. Louis, MO, USA). Mouse metabolic testing and fasting methods followed established protocols [16,33,34].
-
bioRxiv - Immunology 2020Quote: Blood was withdrawn at the indicated times during high fat diet period and plasma lipid levels were enzymatically measured using ELISA (Sigma Aldrich, Zwijndrecht, the Netherlands).
-
bioRxiv - Bioengineering 2022Quote: ... Peanut-specific IgG1 was detected using goat anti-mouse IgG1-HRP conjugated (Southern Biotechnology Associates) and substrate TMB liquid substrate system for ELISA (Sigma-Aldrich, St. Louis, MO). The plates were read in an ELISA plate reader at 405 nM (IgE ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell death detection enzyme-linked immunosorbent assay PLUS (ELISA) and human anti-β-actin antibody were obtained from Sigma-Aldrich (Saint-Quentin-Fallavier, France). Poly-ADP-ribose polymerase (PARP ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 μL 500 mM iodoacetamide (IAA, Sigma-Aldrich) were added and the sample was incubated in darkness for 30 min ...
-
bioRxiv - Biophysics 2021Quote: ... 5(6)-Carboxyfluorescein was purchased from Sigma-Aldrich. Methyl-α-cyclodextrin (MαCD ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 mM tris(2-carboxyethyl)phosphine hydrochloride (Sigma), 1X cOmplete Protease Inhibitor Cocktail (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Tubulin (B-5-1-2, Sigma), mouse anti-CHC (X22 ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μl of 10% Evans blue (Sigma, E2129) was slowly injected into the cisterna magna at a rate of about 1 μl/min over 5 min ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/mL cholesterol (Sigma-Aldrich, BioReagent grade), 25 mM potassium phosphate pH 6.0 ...
-
bioRxiv - Microbiology 2021Quote: ... 6 mM MnCl2 (Sigma-Aldrich, 7773-01-5), 0.7 mM dNTPs with 10 U SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 20 µM pyridoxal 5-phosphate monohydrate (PLP) (Sigma), 20 mM EDTA (Sigma ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μM BHT from Sigma (B1378-100 G), and 3 mM deferoxamine from Sigma (# BP987) ...
-
bioRxiv - Developmental Biology 2021Quote: For 5-bromo-2-deoxyuridine (BrdU; Sigma-Aldrich) incorporation ...