Labshake search
Citations for Millipore Sigma :
3001 - 3050 of 10000+ citations for PGFM ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... was amplified by PCR from a stock of Phi29 phages using primers 5’ACCATGGATCCCATATGCCGAGAAAGATGTATAG3’ and 5’ACCATGAATTCTCGAGTTATTTGATTGTGAATGTG3 (restriction sites underlined) and cloned into the NdeI and EcoRI sites of pET28a (Novagen) introducing a N-terminal His6-tag ...
-
bioRxiv - Genomics 2019Quote: ... 1.5 g/L (days 0-5 and days 11-28) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM (days 3-10 ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transduced with 5 μl (2× 108 IU/μl) viral solution together with 5 μg/ml polybrene (EMD Millipore) for 5-7 days ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked at room temperature with either 5% (w/v) milk or 5% (w/v) bovine serum albumin (BSA, Sigma) in PBS containing 0.1% Tween 20 ...
-
bioRxiv - Biophysics 2021Quote: ... Microcrystals 1-5 × 5-10 × 10-20 μm3 in size were passed through 100 micron plastic mesh filters (Millipore, USA) in the same mother liquor composition to eliminate the large single crystals and other impurities before the data collection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Membranes were blocked in 5% BSA TBS-T (5% BSA in 1x Tris Buffered Saline, 0.1% Tween 20, Sigma Aldrich) for 1 hour and incubated with primary antibodies overnight in 5% BSA TBS-T (MMP1 1:1000 ab137332 ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were then added to the motility mix (TIRF Assay Buffer supplemented with 5 mM ATP, 5 mM phosphocreatine (#P7936, Sigma), 7 U/ml creatine phosphokinase (#C3755 Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µg of purified MurA protein were mixed with 10 mM uridine 5′-diphospho-N-acetylglucosamine (UDP-GlcNAc, Sigma-Aldrich) in a reaction buffer containing 100 mM Tris-HCl pH8.0 and 150 mM NaCl (final volume ...
-
bioRxiv - Microbiology 2021Quote: ... glucose were pelleted by centrifugation and resuspended in 5 mL YNBNAG11 pH 5.1 containing 5 μM 3-MB-PP1 (EMD MILLIPORE) or DMSO as a vehicle control ...
-
bioRxiv - Biochemistry 2022Quote: ... Crystals for NS3H-AMPPNP-Mn2+ complex were obtained by co-crystallization of NS3H (2.2 mg/ml) with 5 mM MnCl2 and 5 mM AMPPNP (Sigma Aldrich) in 0.1 M Bis-Tris Propane pH 6.5 ...
-
bioRxiv - Biochemistry 2022Quote: ... Crystals for NS3H-ADP-Mn2+ complex were obtained by co-crystallization of NS3H (2.2 mg/ml) with 5 mM MnCl2 and 5 mM ADP (Sigma Aldrich) in 0.1 M Bis-Tris Propane pH 6.5 ...
-
bioRxiv - Physiology 2022Quote: ... Cells were washed with PBS three times for 5 min and incubated with blocking buffer consisting of 5% goat serum (CST) and 0.3% Triton X-100 (Sigma Aldrich) in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 5-16-day old females were fed sheep blood supplemented with 2 mM adenosine 5’-triphosphate (ATP) (Sigma Aldrich, A6419) in aqueous sodium bicarbonate buffer using a new artificial membrane feeder called the blood puck ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.5 g/L (days 0-5 and days 11-14) or 2.5 g/L (days 6-10) NaHCO3 (Sigma-Aldrich), and 0.25 mM ascorbic acid (days 3-10) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Setx+/+ and Setx-/- mouse embryonic fibroblasts (MEFs) were cultured at 37°C with 5% CO2 and 5% O2 in DMEM supplemented with 15% FBS (F2442; Sigma) and 1% P/S ...
-
bioRxiv - Molecular Biology 2020Quote: ... and overlaid with 0.5 μl of the matrix solution (α-cyano-4-hydroxycinnamic acid in 50% acetonitrile/0.1% TFA; 5 mg/ml, Sigma). Peptide mass maps of proteins in Figures 4f ...
-
bioRxiv - Biophysics 2020Quote: ... Microcrystals 1-5 × 5-10 × 10-20 μm3 in size were passed through 100 micron plastic mesh filters (Millipore, USA) in the same mother liquor composition to eliminate the large single crystals and other impurities before the data collection ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmodium-specific forward and reverse primer (12.5 pmol; Plas-7F 5’-GTTAAGGGAGTGAAGACGATCAGA-3’ and Plas-171R 5’-AACCCAAAGACTTTGATTTCTCATAA-3’; Sigma-Aldrich), PhHV-specific forward and reverse primer (15 pmol ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in running tap water for 5 min and stained in Biebrich Scarlet-Acid Fucsin for 5 min (#HT151, Sigma). Sections were rinsed in de-ionized water and re-fixed in freshly made Phosphomolybdic/Phosphotungstic/dH2O (1:1:2 ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then labeled for 5 hours at 4C in 50 μL HBSS with 5 mg/mL bovine serum albumin (BSA, Sigma) with 10 μg/mL wheat-germ agglutinin (WGA ...
-
bioRxiv - Microbiology 2022Quote: ... Metabolite sample (5 μL) was injected onto a ZIC-pHILIC 2.1 × 150 mm (5 μm particle size) column (EMD Millipore). Buffer A was 20 mM ammonium carbonate ...
-
bioRxiv - Neuroscience 2022Quote: ... Membranes were blocked in blocking buffer (5% non-fat milk or 5% FBS diluted in TBS-T buffer (0.05% Tween-20 (Sigma-Aldrich) in tris-buffered saline (TBS) ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by spreading serial dilutions on MRS agar or SDM agar supplement of 100 μg/ml 5-Fluorouracil (5-FU) (Sigma). The colonies from MRS agar were replicated to MRS agar containing 10 μg/ml chloramphenicol ...
-
bioRxiv - Immunology 2019Quote: ... membranes were incubated with the indicated primary antibody in either PBST containing 5% skim milk or 5% (w/v) BSA (Fraction V, Sigma) for at least 1h at RT or overnight at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... 3hr 45min following FSA gavage mice were gavaged with 200 μl Evans Blue (5% suspended in 5% Gum Arabic; Sigma). Four hours after FSA gavage and 15 min after Evans Blue gavage animals were anesthetized with isofluorane and blood was drawn by cardiac puncture for serum FSA content ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Superovulation was induced in 4- to 16 week-old female mice by i.p injection of 5 IU of pregnant mare serum gonadotropin (5 IU, PMSG; EMD Millipore) at 14:30 and 48 hours later with 5 IU of human chorionic gonadotropin (5 IU ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and oligonucleotides recognizing both lacO (5′-CATGTGGAATTGTGAGCGGATAACAATTTGTGG-3′) and Gal4 (5′-TCGACGGAGGACAGTCCTCCG-3′) sequences labelled with Biotin were purchased (Sigma). Oligonucleotides were mixed at 100 ng/μL and resuspended in hybridization buffer (50% formamide ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing 5% nonfat dry milk and incubated overnight at 4°C with primary antibody diluted in PBST–5% nonfat dry milk or 5% bovine serum albumin (BSA, Sigma). Membranes were subsequently washed with PBST and incubated with the appropriate IRDye 680RD and IRDye 800CW secondary antibody (LI-COR Biosciences ...
-
bioRxiv - Biochemistry 2020Quote: To examine the RNA binding mode of the N-NTD we used a commercially available 7mer RNA duplex that was prepared by annealing of RNA oligonucleotides 5’-CACUGAC-3’ and 5’-GUCAGUG-3’ (Sigma). The RNA oligonucleotides were mixed in a molar ratio 1:1 at the final concetration 200 μM of each oligonucleotide and water supplemented with 50 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... genomic DNA was extracted from ear clips and amplified by polymerase chain reaction (PCR) using the relevant forward (FP: 5’AAACTGGGCTCTCCGCTGCTG3’) and reverse (RP:5’AGTAGAGTATCGTGCATGGTCCTGG3’) primers (Taq polymerase (Sigma) at an annealing temperature (Tm ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were blocked for 1 h at room temperature in 5% non-fat dry milk (Marvel) or 5% BSA (Sigma) in Tris-buffered saline (TBS ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 10 mM NaHCO3, 5 mM trehalose, 115 mM sucrose, 5 mM sodium HEPES, pH 7.2, all supplied by Sigma-Aldrich) was added and the lateral flaps were fastened with four needles to stretch the body wall ...
-
bioRxiv - Cell Biology 2019Quote: ... SC medium could contain 0.5% lactate as a carbon source (from a 5% stock adjusted to pH=5; Sigma Aldrich). Pre-cultures of 4mL were incubated at 30°C for 8 hours and diluted in fresh medium on the evening to 20mL cultures grown overnight with inoculation optical densities (OD600 ...
-
bioRxiv - Physiology 2020Quote: ... was dissolved in vehicle solution containing 5% dimethyl sulfoxide (Scharlab, Sentmenat, Spain) and 5% cremophor EL (Sigma-Aldrich, Steinheim, Germany) in sterilized water and filtered with a 0.22 µm filter (Millex GP ...
-
bioRxiv - Cell Biology 2020Quote: ... The labelling media was replaced with growth factor deprived MCF10A culture media containing 5 mM L-cysteine and 5 mM L-methionine (Sigma) for indicated times ...
-
bioRxiv - Neuroscience 2021Quote: ... HT22 cells were infected with lentivirus carrying the control scrambled-shRNA (5’-CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG-3’) or CB-specific shRNA (5’-CCGGGATTGGAGCTATCACCGGAAACTCGAGTTTCCGGTGATAGCTCCAATCTTTTTG-3’) with polybrene (Sigma) for two days ...
-
bioRxiv - Physiology 2021Quote: ... Membranes were blocked on a 5% dry nonfat milk solution or 5% BSA with Tris-buffered saline (TBS) with 0.1% TWEEN® 20 (Sigma) at room temperature for 1 hour ...
-
bioRxiv - Biochemistry 2021Quote: An RNA oligonucleotide (5′ -UUUUCAUGCUACGCGUAGUUUUCUACGCG-3′; 4N) with Cyanine 5.5 at the 5′-end was obtained from Millipore Sigma (USA). The RNA scaffold was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: High performance liquid-chromatography-purified RNA oligonucleotides 5’-(UG)12-3’ and 5’-(UC)12-3’ were ordered from Sigma. The oligonucleotides were biotinylated using the Pierce RNA 3’ End Desthiobiotinylation kit (Cat n° 20163 ...
-
bioRxiv - Genetics 2021Quote: ... were superovulated by serial Pregnant Mare Serum Gonadotropin (5 IU per mouse, Prospec Protein Specialists) and human chorionic gonadotropin (5 IU, Millipore) injections 46 h apart ...
-
bioRxiv - Microbiology 2020Quote: ... schizont stage parasites enriched from 5-10 mL of culture at 5-10% parasitemia were treated with 0.15% saponin (Sigma Aldrich) and protease inhibitor (Cat ...
-
bioRxiv - Genomics 2020Quote: ... An additional 5 μg/mL αF was then added at the same time as 5 μg/mL CPT (Sigma-Aldrich). The cells were pelleted for DNA extraction 2.5 h after adding the CPT ...
-
bioRxiv - Immunology 2021Quote: PBMCs and tissue MNC suspensions were treated with 5 μM Chk2 inhibitor II or 2-[4-(4-chlorophenoxy)phenyl]-1H-benzimidazole-5-carboxamide (Sigma) prepared in final volume of 1% bovine serum albumin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... or 0.5 μM/ml 5-amino-6-D-ribitylaminouracil (5-A-RU) (courtesy of Jeffrey Aubé, UNC) and 50 μM/ml Methylglyoxal (Sigma). Brefeldin A Solution (Biolegend ...
-
bioRxiv - Microbiology 2022Quote: ... GW4869 (0-100 μM), Trichostatin A (TSA, 0-100 nM), RG108 (0-100 nM), or 5-Azacytidine (5-AC, 0-50μM) (SIGMA, USA). The effect of drug treatment on the parasites was monitored by infecting human fibroblasts with KU80-GFP bradyzoites or RH-YFP tachyzoites (70 ...
-
bioRxiv - Microbiology 2022Quote: ... in PBS for 5 min at RT and incubated with 5% bovine serum albumin (BSA, Sigma-Aldrich, St. Louis, MO) for 1h at RT ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5 male and 5 female mice received a unilateral intraplantar injection of CFA (10uL, F5881, Sigma Chemical, St. Louis, MO). Mechanical paw withdrawal thresholds were collected prior to CFA injection ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were rinsed 3X (5 min each) in tris-buffered saline (TBS) and blocked in 5% normal goat serum (catalog #G9023, Millipore) for 1h at room temperature ...
-
bioRxiv - Physiology 2022Quote: The membrane-permeable 8-Br-cGMP (8-bromoguanosine 3′,5′-cyclic monophosphate, B1381) and 8-Br-cAMP (8-bromoadenosine 3′,5′-cyclic monophosphate, B5386) were from Sigma. ANP (AS-20648) ...