Labshake search
Citations for Millipore Sigma :
3001 - 3050 of 10000+ citations for 6 Chloro 7H pyrrolo 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and 6% bovine serum albumin (Sigma, #AA0281) solution ...
-
bioRxiv - Zoology 2024Quote: ... (6) treated with antibiotics (penicillin streptomycin, Sigma P4333 ...
-
bioRxiv - Plant Biology 2024Quote: ... urea (CAS no. 57-13-6, Sigma), SR2200 (Renaissance Chemicals) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 6 mM cis-aconitate (Sigma-Aldrich) at 28°C ...
-
bioRxiv - Genetics 2023Quote: ... 6-hexanediol (Sigma, catalogue no.240117-50G), or various redox states (68) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 6% bovine serum albumin (Sigma, #AA0281) blocking solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... Hyaluronidase (Sigma, H3506, 6 U/mL final) and Collagenase XI (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... PGE2 (Sigma-Aldrich, P0409, 10-6 µM), or indomethacin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6-mercaptopurine (852678-5G-A Sigma Aldrich), mizoribine (S1384 Selleck Chemicals) ...
-
bioRxiv - Cell Biology 2024Quote: ... and pancreatin (Sigma Aldrich #8049-47-6). After enzymatic dissociation ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-OHDA (3ug in 0.6ul) (Sigma Aldrich) was infused unilaterally into the medial forebrain bundle (MFB ...
-
bioRxiv - Neuroscience 2024Quote: ... pups received 6-OHDA (Sigma-Aldrich, France) or vehicle in one of the lateral ventricles as described in (45) ...
-
bioRxiv - Immunology 2024Quote: ... urea (3M; 57-13-6, Merck Millipore) was added for 10 minutes to break the AMPK-Sestrin2 binding followed by incubation with the anti-Sestrin2 antibody (1:100 ...
-
bioRxiv - Microbiology 2024Quote: ... 6 % (w/v) SDS (Sigma-Aldrich, #8.22050), 0.3 % (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were incubated with 15 μM substrate 2′ (4-methylumbelliferyl)-α-D-N-acetylneuraminic acid (4MU-NANA) in 37°C warmed sterile filtered TBS (Sigma Aldrich; St. Louis, MO). Fluorescence intensity (excitation ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Cancer Biology 2019Quote: ... ADORA1 selective and competitive antagonists 1-Butyl-3-(3-hydroxypropyl)-8-(3-noradamantyl) xanthine (PSB36) and 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) (Sigma-Aldrich); ADORA2b selective antagonist 4-(2,3,6,7-Tetrahydro-2 ...
-
bioRxiv - Plant Biology 2020Quote: ... inflorescences were soaked in 3% (w/v) 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (Sigma Chemical, St. Louis, MO, USA, E6383) with 0.05% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2020Quote: ... 14-3-3 antibody and active recombinant AMPK (α2β1γ1) were from Millipore. Precast Tris-Glycine polyacrylamide gels and 10X tris-glycine gel electrophoresis buffer were from BioRad ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC-HCl, Sigma Aldrich, 8510070025), chlorosulfonic acid (Sigma 571024) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... in the presence of 1 mM 3-aminotriazol (3-AT) (Sigma-Aldrich). Results were expressed in the form of a heat map for the strength of interaction according to the colony growth after five days of incubation at 30°C.
-
bioRxiv - Neuroscience 2021Quote: ... and developed using 3-3’-diaminobenzidine (DAB; Sigma-Aldrich, St. Louis, MO) as the chromogen.
-
bioRxiv - Microbiology 2021Quote: ... N-(3-oxododecanoyl)-l-homoserine lactone (3-oxo-C12-HSL, Millipore Sigma); and a rhamnolipid mixture (RHL ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 7.00 g; Sigma) (molar ratio of NHS:EDC = 1:2 ...
-
bioRxiv - Immunology 2024Quote: ... HRP activity was detected with SIGMAFAST 3-3’Diaminobenzidine tablets (Sigma-Aldrich), whereas alkaline-phosphatase activity was detected using naphtol AS-MX phosphate and fast blue salt with levamisole (All from Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC-HCl; Sigma-aldrich) were added at a concentration of 0.47 and 0.95 mg mL-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... then 0.2 mmol 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) (Sigma, USA) and 0.2 mmol N-Hydroxy succinimide (NHS ...
-
bioRxiv - Bioengineering 2024Quote: ... followed by 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC; Sigma-Aldrich) were added drop-wise at 5000 molar equivalents to the alginate solution while stirring ...
-
bioRxiv - Neuroscience 2024Quote: ... a 3 mm-thick agar gel cap (Sigma, 3% in distilled water) was placed between the head and the surface coil ...
-
bioRxiv - Neuroscience 2024Quote: ... The two odors used were 3-octanol (3-Oct) (Sigma-Aldrich 218405) and 4-methyl-cyclohexanol (MCH ...
-
bioRxiv - Genomics 2020Quote: ... cells were harvested and grown for 5-6 passages in NPC expansion medium (selection medium with the addition of 2% B27 [GIBCO], 20 ng/ml bFGF [Sigma], and 20 ng/ml EGF [Sigma]) before collection for single-cell analysis ...
-
bioRxiv - Plant Biology 2021Quote: The dried samples were derivatized for 2 hours at 37 °C in 50 μI of 20 mg ml-1 methoxyamine hydrochloride (Sigma-Aldrich, cat. no. 593-56-6) in pyridine followed by a 30 min treatment at 37 °C with 100 μI of N-methyl-N-(trimethylsilyl)trifluoroacetamide (MSTFA reagent ...
-
bioRxiv - Immunology 2024Quote: ... we used inhibitors of ERK1/2 (Trametinib, SelleckChem, Catalog # S2673), p38 (Losmapimod, Selleckchem Catalog #S7215), NF-kB (BAY11-7082, Catalog # S2913) and JNK inhibitor (Millipore-Sigma Catalog # CAS 129-56-6) 2 hr before stimulation with R848 or Poly I:C until sample collection at 8 or 24hrs for mRNA or protein levels of antiviral and inflammatory cytokines and chemokines.
-
bioRxiv - Immunology 2021Quote: ... Cells were cultured in a 24-well plate (500’000 cells/well) in complete IMDM supplemented with 6 ng/ml IL-6 (Sigma), 6 ng/ml IL-3 (eBioscience ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatants were incubated with 6 µl anti-HA (12CA5, in-house preparation) or 6 µl anti-T7 (69522, Millipore) and protein G-dynabeads (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... Loaded PDMS chambers were incubated for 30 minutes at 37°C and after polymerization muscle bundles were kept in normal proliferation medium containing 1.5 mg/ml 6-aminocaproic acid (6-ACA) (Sigma). After 2 days ...
-
bioRxiv - Neuroscience 2022Quote: Partial bilateral neostriatal dopamine lesions were made by injecting 6-OHDA (6 μg/μL, Sigma-Aldrich, St. Louis, MO) dissolved in ascorbic saline (de-ionized water containing 0.9% NaCl and 0.1% ascorbic acid ...
-
bioRxiv - Cell Biology 2022Quote: C57Bl/6 mice (6 weeks-old) were treated with an ip injection of 1500 mg TAA/kg (Sigma-Aldrich) to induce ALF ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...
-
bioRxiv - Neuroscience 2024Quote: ... each mouse received a bilateral injection of 1.25 μl of 6-hydroxydopamine hydrochloride (6-OHDA, Sigma-Aldrich, 4μg/μl) or vehicle (0.9 % NaCl + Ascorbic Acid 0.02% ...
-
bioRxiv - Immunology 2024Quote: ... BEAS-2B.MR1-GFP cells were incubated with 94 μM 6-formylpterin (6-FP, Schircks) or the equivalent volume of 0.01 M NaOH (Sigma) overnight at 37°C at 5e4/well in a 24-well plate ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-OHDA rats received 2.3 μL bilateral injections of 6-OHDA hydrobromide (6 μg combined with ascorbic acid dissolved in 2.3 μL sterile 0.9% NaCl, Sigma Aldrich) in the SNc in each cerebral hemisphere ...
-
bioRxiv - Developmental Biology 2023Quote: Pups were injected once daily intraperitoneally with 6-hydroxydopamine hydrochloride (6-OHDA) 50ug/g of body weight (Sigma H4381) from post-natal day 0 to 5 ...
-
bioRxiv - Biophysics 2019Quote: ... 3 μL benzonase (Novagen) and sonicated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μM CHIR99021 (Sigma), 1 μM PD0325901 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 % donkey serum (Millipore) and 0.5 % Triton X-100 in PBS at RT for 3 h ...
-
bioRxiv - Developmental Biology 2020Quote: ... 3) Progesterone (Sigma P8783) – 0.02 µg/ml final concentration ...