Labshake search
Citations for Millipore Sigma :
2951 - 3000 of 10000+ citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... 5 dpf larvae were fixed in 4% paraformaldehyde (PFA; Sigma) in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: ... 4 or 6 h with staurosporine (5 µg/ml, Sigma) at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/ml of mouse recombinant IL-4 (Sigma-Aldrich), and 0.5 μg/ml anti-CD180 (RP/14 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 µM 5-fluoro-2′-deoxyuridine (FldU, Sigma-Aldrich) were added to the cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/ml mouse recombinant IL-4 (Sigma-Aldrich) to allow B cell activation and class switch recombination to IgG1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 100μm of 4-AP (Sigma-Aldrich, CAS#: 504-24-5) was washed on for 3 minutes (the amount of time it took to regularly induce 4-AP oscillations ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by fixation in 4% formaldehyde (EMD Millipore FX0410-5) in 1X PBS with Triton X-100 (0.3% ...
-
bioRxiv - Immunology 2024Quote: ... or 4 mM EGTA (CAS 67-42-5, Sigma-Aldrich) were added to buffers as outlined in the text.
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 μL of thrombin (4 units/ml, Sigma, UK) were mixed ...
-
bioRxiv - Neuroscience 2024Quote: ... 5′-cyclic monophosphate (dibutyryl cAMP) (Sigma-Aldrich, 60-92-4) and 2 ng/mL GDNF (Pepro Tech ...
-
bioRxiv - Molecular Biology 2021Quote: A CU RNA hairpin (5’-AAAAGAAAAGACGCGUAGUUUUCUACGCG- 3’) labeled with Cyanine 5.5 at the 5’-end (Millipore Sigma) was annealed in 20 mM HEPES ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA damage was induced where indicated by treatment with 2 μg/ml 4-Nitroquinoline 1-oxide (4-NQO) (Sigma) for 60 min before harvesting ...
-
bioRxiv - Neuroscience 2021Quote: ... the mice were given an intraperitoneal injection of 10 mg kg-1 of 4-hydroxytamoxifen (4-OHT; Sigma, H6278) dissolved in a 1:4 mixture of castor oil (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... tadpoles were euthanized using MS-222 (1 g/L) and fixed in 4% paraformaldehyde (Sigma - CAS 30525-89-4) for 3 h at room temperature (RT) ...
-
bioRxiv - Genetics 2023Quote: ... embryos were fixed in 4% paraformaldehyde overnight at 4°C, washed in PBST (1× PBS, 0.1% Tween 20 (Sigma)) ...
-
bioRxiv - Neuroscience 2023Quote: ... and the sample was incubated for 1.5h rotating at 4°C before the addition of 1/4 volume of 3.06% cycloamylose (Sigma-Aldrich). The sample was incubated overnight rotating at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... Cells were transferred to 2.5 ml HUDEP expansion media supplemented with 2x DOX and 7.5 µM RAD51-stimulatory compound 1 (RS-1, Sigma). After two days cells were pelleted (5 min ...
-
bioRxiv - Biophysics 2021Quote: ... was grown in tryptone broth (10 g I−1 Tryptone, microbiologically tested, Sigma Aldrich, 5 g I−1 NaCl) in an orbital shaker overnight at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... the mouse anti-alpha-tubulin B-5-1-2 was used at a dilution of 1:500 (Sigma, T5168). Polyclonal rabbit anti-TgCentrin1 (Fig ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The lyophilised samples were each resuspended in 5 ml of a 1:1 mixture of DMSO:TEA/3HF (Sigma-Aldrich), incubated at 65°C for 2.5 hours ...
-
bioRxiv - Pathology 2021Quote: ... The serum samples were serially diluted (4-fold from 1:400 to 1:409600) in 5% skim milk in PBS (pH 7.2) containing 0.05% Tween 20 (Sigma-Aldrich) (PBS-T) ...
-
bioRxiv - Biochemistry 2021Quote: ... we first prepared three solutions of 1) 5 mM ALP-TCO and 1 mg/mL p-NPP (Millipore-Sigma), 2 ...
-
bioRxiv - Biochemistry 2021Quote: ... we first prepared three solutions of 1) 5 mM ALP-TCO and 1 mg/mL p-NPP (Millipore-Sigma), 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... the ability to reverse the nonresponsive phenotype for astrocytes in 0% BSA was tested by >1 hour incubation prior to and for the duration of flow experiments with 1 µM S1P (stock 0.2 mM in 1:5 methanol:water, Sigma #S9666) in 0% BSA flow media using Protocol 1 ...
-
bioRxiv - Plant Biology 2023Quote: Powder resulting of MSC surface abrasion was chemically extracted in the collector tube with extraction buffer (80 μL of 5 mM sodium acetate pH 4.6 containing 1 μL.mL−1 of plant protease inhibitor cocktail (Sigma P9599) per mg of powder) ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.5 μM (with apoptosome at a molar ratio of 1:5:10 caspase-9 : Apaf-1 : cytochrome C (SIGMA)) in the following buffer conditions ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
The RIFF: an automated environment for studying the neural basis of auditory-guided complex behaviorbioRxiv - Neuroscience 2021Quote: ... and 1:1 mixture of 4% sucrose and 0.1 % saccharine solutions (sucrose and saccharin, Sigma-Aldrich, St. Louis, MO, USA).
-
bioRxiv - Genetics 2021Quote: ... and 0.1% (w/v) SDS) containing 1× homemade protease inhibitor cocktail (1 mM 4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride (Sigma; A8456), 0.3 μM Aprotinin ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Frozen brain tissue was ground with a motorized pestle for 30 s in 100 µl of chilled (4:1) analytical grade methanol:ddH2O with 1 mM norluecine (Sigma Aldrich) standard ...
-
bioRxiv - Neuroscience 2020Quote: ... a 1:1 mixture of 4% HMS (2% final concentration) and 20% bovine serum albumin (BSA; 10% final concentration; V900933, Sigma), incubated at 4°C for 1 week ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated overnight at 4°C with guinea pig anti-vGlut2 antiserum (1:12,000, cat# AB2251-1, Millipore Sigma) in PBS-T containing 2% normal donkey serum ...
-
bioRxiv - Cell Biology 2020Quote: ... For AsiSI or I-PpoI nuclease induced DSBs, cells were treated with Shield-1 (1 μM, AOB1848, Aobious) and 4-OHT (2 μM, H7904, Sigma) for 5 hours before washing with PBS and adding back media.
-
bioRxiv - Plant Biology 2021Quote: ... 1 g of the infiltrated leaf tissue was ground in 4 mL of extraction buffer (1/2 tablet of Sigma Complete™ mini protease inhibitor (per 15 mL) ...
-
bioRxiv - Microbiology 2021Quote: ... Cultures were then diluted 1:100 in prewarmed minimal media A containing 4 µg mL-1 polymyxin B sulfate (Sigma). Samples were incubated at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... blots were blocked for 1 h and incubated overnight at 4 °C with anti-Amyloid fibrils (OC, 1:5000, Merck-Millipore), anti-prefibrillar oligomers (A11 ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were centrifuged for 5 min at 20 000 x g and supernatants were immunoprecipitated for 1 h rotating at 4°C with mouse anti-GFP antibody (1 µg antibody per sample, 11814460001 Merck/Sigma) and 20 µl DynabeadsTM Protein G (10004D ...
-
bioRxiv - Neuroscience 2022Quote: ... the sections were incubated overnight at 4 °C with the primary antibodies: mouse anti-Syntaxin-1 (1:500, Sigma, # S0664), chicken anti-GFP (1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... for 2 hours and stained with primary antibodies overnight at 4°C (guinea pig anti-vGlut2, 1:1000, Millipore AB2251-I; guinea pig anti-vGlut1, 1:1000, Millipore AB5905 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and expression of the protein was induced for 4 hours with 1 mM isopropyl 1-thio-B-D-galactopyranoside (Sigma) at 18°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Cells were cultured in 4 mL CgXII medium containing 13C-1-glucose or 13C-1-fructose (Sigma-Aldrich, Taufkirchen, Germany) as sole carbon sources ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were incubated for 48 h at 4 βC with primary antibodies (rat anti-BrdU, 1:500, OBT Serotec; mouse anti-NeuN, 1:200, MAB377, Millipore; rabbit anti-S100β ...
-
bioRxiv - Microbiology 2021Quote: ... tissues were incubated until dissolved at 37°C in 495 μL extraction buffer [(4 M urea, 0.2 M NaCl, 1 mM trisodium citrate, 1% SDS (Sigma-Aldrich)] supplemented with 5 μL Proteinase K (20 mg mL−1 ...
-
bioRxiv - Neuroscience 2021Quote: ... the cells were incubated with the primary antibodies of interested proteins at 4°C overnight (Nestin, 1:1000, Sigma; Tuj1, 1:1000, Sigma; GFAP ...
-
bioRxiv - Microbiology 2021Quote: ... Phage 80α stock was diluted in phage buffer (50 mM Tris-HCl pH 7.8, 1 mM MgSO4, 4 mM CaCl2 and 1 g/L gelatin; Sigma–Aldrich), and added to the master mix to reach the desired starting concentration in plaque forming units per mL (pfu/mL) ...
-
bioRxiv - Physiology 2023Quote: ... sections were exposed overnight at 4°C to antibodies detecting CARNS1 (rabbit polyclonal, 1:100 in PBS with 1% BSA, HPA038569, Sigma). The next day ...
-
bioRxiv - Cell Biology 2023Quote: ... the reaction between peptide conjugate and crosslinkers (PEG-4VS and PEG-4 ACLT) was performed in stoichiometric ratio 1:1 in30mM HEPES buffer at pH 8 (Sigma) diluted in 1x HBSS (Gibco) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were diced into small pieces using razor blades and incubated for 1 h in digestion medium (RPMI-1640 with 1 mg/mL collagenase type 4, Sigma) at 37°C ...