Labshake search
Citations for Millipore Sigma :
2901 - 2950 of 10000+ citations for Mouse AWAT2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... was obtained from Thermofisher Scientific (Waltham, Massachusetts) and the expression plasmid pET11d from Millipore Sigma (Burlington, Massachusetts).
-
bioRxiv - Immunology 2023Quote: ... commercially available plasmids (pCMV-Cas9-RFP and pCMV-Cas9-GFP) from Sigma-Aldrich was used targeting sequence AATACATACCGTCAGAAGCAGG in exon 3 of EIF2AK2 (PKR ...
-
bioRxiv - Immunology 2023Quote: ... and plasmid DNA was isolated using GenElute™ HP Maxiprep Kit (Millipore Sigma) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with NF-κB Luciferase reporter plasmid using polyethylenimine (PEI, Sigma). The culture medium was refreshed 8 h post-transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... Free genomic and plasmid DNA was digested with a Benzonase Nuclease (Sigma-Aldrich). Cell debris was removed by centrifugation and ...
-
bioRxiv - Bioengineering 2023Quote: ... coli XL-I Blue transformants with the Sigma GenElute Plasmid Kit (Sigma-Aldrich) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The Cre-recombined ROSA-Kaleidoscope plasmid and Fast Green FCF dye (MKCD1540, Sigma) were mouth-pipetted through glottis until embryonic lumens were visibly filled ...
-
bioRxiv - Molecular Biology 2023Quote: Cells were transfected with plasmid DNA using Gene Juice Transfection Reagent (Merck Millipore) 24 h after plating ...
-
bioRxiv - Cancer Biology 2023Quote: ... gag-pol and env plasmids using X-tremeGENE HP transfection reagent (Sigma, 6366236001). The supernatants were used to infect U2OS cells ...
-
Autophagy suppression in DNA damaged cells occurs through a newly identified p53-proteasome-LC3 axisbioRxiv - Cell Biology 2024Quote: ... and CdtC subunits (within pET-15b protein expression plasmids; #69661, Sigma-Aldrich, USA), each expressed with an amino-terminal polyhistidine fusion peptide ...
-
bioRxiv - Cell Biology 2024Quote: ... The plasmid mixture was added to 1mL of 278 uM CaCl2 (Sigma C1016) and mixed thoroughly before adding 1mL of 2x BBS solution [280 mM NaCl (Fisher Scientific S271-1) ...
-
bioRxiv - Genomics 2024Quote: ... and plasmid DNA was transfected into HEK293T cells using the PEI reagent (Sigma). After 48 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 500,000U Recombinant Mouse LIF Protein (Millipore Cat#ESG1107)) with feeders ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-Vimentin mouse monoclonal (1:1000, 1A4, Sigma), anti-Fibronectin rabbit polyclonal (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Antibodies to β-actin (Mouse Monoclonal, #A5441 (Sigma), 1/10000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti β-actin 1:20,000 (Sigma, A1978), rabbit anti-ubiquitin 1:1,000 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... mouse anti-Calretinin (1:250, Cat. #: AB5054, Millipore); rabbit anti-phospho-Erk1/2 (1:250 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-α-tubulin (mouse, Sigma, T5168, RRID 477579). Antibodies were raised in rabbits against purified ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag mouse monoclonal antibody (M2, Sigma, 1:1000), HA.11 mouse monoclonal antibody (16B12 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-insulin (1:350, Sigma, #K36AC10), mouse monoclonal anti-proinsulin (1:100 ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse anti-β-catenin ascites fluid (C7082, Sigma); rabbit Ab to α-catenin (ab2981 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-α tubulin (T9026, Sigma-Aldrich) at 1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: ... or β-actin (mouse monoclonal AC15, Sigma-Aldrich). Proteins were visualized with goat anti-mouse or goat anti-rabbit IRDye-800 or - 680 secondary antibodies (LI-COR Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-SC-35 (1:2500, Sigma, #S4045), rabbit anti-HNRNPA1 (1:2500 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal TUBA4A (Sigma-Aldrich, T5168, 1:4000), GAPDH (14C10 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal y-Tubulin (cat. No. T6557, Sigma), mouse monoclonal SF3B1 (cat ...
-
bioRxiv - Cell Biology 2020Quote: ... or 10 µg of mouse IgG (Sigma-Aldrich) in 200 µl of PBS + 0.1% (v/v ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Tubulin (B-5-1-2, Sigma), mouse anti-CHC (X22 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-RAB10 (1:1000; Sigma; SAB53000028), rabbit polyclonal anti-RAB7 (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal anti-flag (1:500; Sigma, F1804), mouse monoclonal anti-tubulin (clone DM1A ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse monoclonal V5 (1:250, Sigma-Aldrich, V8012) and mouse monoclonal NeuN (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... HRP-conjugated goat anti-mouse secondary antibody (Sigma) was used and tyramide-fluorophore was allowed to react for 30 sec before final washes ...
-
bioRxiv - Cell Biology 2020Quote: ... acetylated tubulin (mouse, 6-11B-1, Sigma-Aldrich), ARL6 (rabbit ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-Tubulin antibody (mouse, 10806, Sigma-Aldrich, USA), anti-DNP antibody (rabbit ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-puromycin (12D10) mouse mAb (Millipore Sigma, MABE343). Secondary antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:1000 mouse anti-Centrin2 (20H5; Sigma-Aldrich), 1:2000 rabbit anti-CEP164 (45330002 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1;1000 mouse anti-α-tubulin (T6199; Sigma-Aldrich), 1:1000 rabbit anti-CP110 (12780-1-AP ...
-
bioRxiv - Cell Biology 2020Quote: ... HRP-conjugated goat anti-mouse secondary antibody (Sigma) was used and tyramide-fluorophore was allowed to react for 30 s before final washes ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-beta actin (clone C4) (EMD Millipore); rabbit anti-TFEB (Bethyl Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-β-tubulin (Sigma Aldrich, CA, USA), rabbit anti-Emerin (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse anti-α-Tubulin (T9026) was from Sigma. Rabbit (A11122 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-phosphotyrosine (1:1000, pY, 4G10, Millipore) followed by secondary Rabbit anti-mouse-HRP ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-actin (1:4000, Sigma-Aldrich, A4700).
-
bioRxiv - Cell Biology 2020Quote: ... mouse α-MAPK-YT (1:500, M8159; Sigma), rabbit α-SYP-2 (1:200 ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-FLAG (Sigma-Aldrich, M2; 1/200); rabbit Anti-FLAG (Sigma-Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... mouse anti-FLAG (Sigma-Aldrich; catalog no. F1804), mouse anti-HA (EMD Millipore ...
-
bioRxiv - Genetics 2021Quote: ... mouse anti-NR1 (1:1000, Merck Millipore, UK), rabbit anti-PSD95 (1:2000 ...
-
bioRxiv - Genetics 2021Quote: ... mouse monoclonal anti-FLAG M2 (Sigma-Aldrich, F1804), and mouse monoclonal anti-MYBPC3 (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GFP (MAB3580, 1: 5000) from Millipore, and mouse anti-γ-tubulin (T5326 ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-HA 12CA5 mouse monoclonal antibody (Sigma-Aldrich) was used at 1:2000 with secondary being anti-mouse-HRP (Sigma-Aldrich ...