Labshake search
Citations for Millipore Sigma :
2851 - 2900 of 10000+ citations for Mouse AWAT2 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... following by primary antibody incubation overnight at 4°C (rabbit anti-pRIPK3, Abcam; mouse anti-TH, Millipore; mouse anti-pMLKL: Millipore rabbit anti-TH ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: The amount of Shh secreted by mouse pancreatic tumor cells was quantified by using the Mouse Shh-N ELISA Kit (#RAB0431, Millipore), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sections were then blocked with 5% normal donkey serum in 1X PBS for one hour before overnight incubation in primary antibodies (Foxf1, goat, R&D, 1:300; Sox9, mouse, Invitrogen, 1:200; Sox9, rabbit, Millipore, 1:200; Acta2, mouse, Sigma, 1:800 ...
-
bioRxiv - Biochemistry 2021Quote: ... and the secondary fluorescence-labeled anti-mouse IgG antibody (2.5 µg/mL; goat anti-mouse IgG, Atto647N, Sigma Aldrich, Germany) were mixed in one batch and offered in a volume of 2 µL to the beads from the opposite side ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated overnight at 4°C in primary antibody diluted in blocking solution (mouse anti-CamKII from Millipore 05-532, rabbit anti-Gluc from Nanolight 401P, mouse anti-GAD67 from Millipore MAB5406 ...
-
bioRxiv - Microbiology 2021Quote: The following primary antibodies were used for immunoprecipitation assay and/or immunoblotting: a mouse anti-Flag and a mouse anti-Flag-HRP antibody (Sigma), a rabbit anti-N antiserum (70) ...
-
bioRxiv - Immunology 2021Quote: ... mouse monoclonal anti Rho-GDI (Santa-Cruz Biotechnology, 1:500) and mouse monoclonal anti-FLAG M2 Ab (Sigma, 1:1000), anti-ERK1/2 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2022Quote: ... These were prepared by preincubating the His-tagged PilC with mouse monoclonal anti-poly-histidine and biotinylated anti-mouse IgG antibodies (both from Sigma) at a ratio of 1:1.5:1.5 (by weight ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein complexes were identified by adding anti-mouse IgG agarose (and mouse IgG agarose as control, #A6531 and #A0919 respectively, both Sigma) for 1 hour at 4ºC in rotation ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies (rat anti-BrdU, 1:100, Abcam; mouse anti-BrdU, 1:100,BD Biosciences; mouse anti-Nestin, 1:300, Millipore; rabbit anti-GFAP ...
-
bioRxiv - Microbiology 2022Quote: ... the microarrays were overlaid with the VP1 proteins for 90 minutes as protein-antibody complexes that were prepared by preincubating VP1 with mouse monoclonal anti-polyhistidine and biotinylated anti-mouse IgG antibodies (both from Sigma) at a ratio of 4:2:1 (by weight ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and incubated with mouse primary anti-Collagen Type II (DSHB II-II6B3) or mouse anti-dopamine 4 receptor (MABN125, Millipore) primary for 2 h at room temperature in a humidified chamber ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Mouse anti-FLAG M2 monoclonal antibody (F1804) and mouse anti-His-tag monoclonal antibody (D291-3S) were purchased from Sigma□Aldrich (St ...
-
bioRxiv - Biochemistry 2023Quote: ... the microarray was overlaid with the VP1 protein for 90 minutes as a protein-antibody complex that was prepared by preincubating VP1 with mouse monoclonal anti-polyhistidine and biotinylated anti-mouse IgG antibodies (both from Sigma) at a ratio of 4:2:1 (by weight ...
-
bioRxiv - Cell Biology 2023Quote: Polyclonal antibody against the C-terminus of mouse SETX-C were generated by immunizing rabbits. Mouse cDNA encoding Setx (aa. 1900-2701) was subcloned into pET15b (Novagen) and transformed to E.coli strain BL21-CodonPlus(DE3)-RIPL (Agilent) ...
-
bioRxiv - Immunology 2021Quote: ... Lenti CRISPR universal non-target plasmid was used as a control (Sigma Aldrich). WT or Relb-/- immortalized MEFs were then transduced with lentivirus and transduced cells were FACS sorted and further selected using puromycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli by co-expression of all subunits from three plasmids: pRSFDuet-1 (Novagen) encoding a HiS7-SUMO-TEV-Rrn9 fusion and Rrn10 ...
-
bioRxiv - Cell Biology 2019Quote: HEK293 cells were transfected with plasmids using polyethylenimine according to manufacturer’s instructions (Sigma). Neurons were transfected by the Ca2+-phosphate method (53) ...
-
bioRxiv - Biophysics 2019Quote: ... We visualized PCR products and DNA plasmids by 1 % agarose (SIGMA Cat.#A9539) gel dyed with GelRed (BIOTIUM Cat.#41003) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We purified the PCR product using the GenElute Plasmid Miniprep Kit (Sigma Aldrich) and used it as a template to insert the mutation into OmpF— transformed with pkD46 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Plasmids encoding for IGPD were transformed into Escherichia coli BL21 (DE3) cells (Novagen) and protein expression was induced for 5 h with 1 mM isopropyl-b-D-thiogalactopyranoside at 37°C in Luria broth ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid was transformed in Escherichia coli Rosetta™ (DE3) pLysS cells (Novagen). Selected colonies were grown in luria broth supplemented with 25 μg/ml chloramphenicol and 25 μg/ml kanamycin at 37 C until an OD between 0.6-0.8 was reached ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA plasmid was then transfected into 4T1 cells using Nanojuice transfection reagent (Millipore). 48 h later ...
-
bioRxiv - Cell Biology 2020Quote: ... and the viral packaging plasmids pMD2.G and psPAX2 using Genejuice (EMD millipore). 72 hr after plasmid transfection ...
-
bioRxiv - Biochemistry 2020Quote: ... Resulting DNA fragment was cloned into NheI/HindIII sites of pET28a+ plasmid (Novagen) to generate pET28-S plasmid ...
-
The circadian clock gene circuit controls protein and phosphoprotein rhythms in Arabidopsis thalianabioRxiv - Systems Biology 2021Quote: ... Plasmids were transformed into Rosetta™2(DE3)pLysS Competent expression strain (Novagen).
-
bioRxiv - Biochemistry 2022Quote: ... individual plasmids were transformed into BL21 Rosetta (DE3) protein expression cells (EMD Millipore).
-
bioRxiv - Molecular Biology 2022Quote: ... Each construct was then cloned into the pET-21b+ plasmid (Novagen, Darmstadt, Germany) and expressed and purified using a C-terminal HisTag® as previously described for the native BefA protein (Hill et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... trimethoprim (TMP) and GenElute HP Plasmid Miniprep kit were acquired from Sigma-Aldrich. ZymoPure Plasmid Midiprep and Maxiprep kits were purchased from Zymo Research ...
-
bioRxiv - Molecular Biology 2019Quote: ... plasmids for different Cas9 proteins were expressed in Escherichia coli Rosetta2 (DE3) (Novagen). The protein expressing Rosetta2 (DE3 ...
-
bioRxiv - Cell Biology 2020Quote: The 6His-tagged-She1Cter expression plasmid for was constructed in pet28 vector (Novagen). The She1 C-terminal part coding for amino-acid 194 to 338 was cloned between the NdeI and XhoI site of the vector downstream of 6His and thrombin site.
-
bioRxiv - Biophysics 2020Quote: ... we transform the resulting plasmids verified by sequencing into BL21(DE3) cells (Novagen) for protein expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... bL33 were PCR-amplified and cloned individually into the pET24(a) plasmid (Novagen). Similarly ...
-
bioRxiv - Developmental Biology 2020Quote: ... The completed plasmid was transformed into Rosetta BL21 cells (Millipore Sigma, 70954-3). A starter culture of 5 ml of Rosetta BL21 cells containing the completed plasmid were grown overnight at 37°C in LB with Kanamycin ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK 293T cells were transfected with Cdt1 expression plasmids using PEI Max (Sigma) and cultured for 16 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1-shDOT1L and pLKO.1-shSTING plasmids were obtained from Sigma-Aldrich with the following TRCN numbers ...
-
bioRxiv - Cancer Biology 2020Quote: ... CRISPR-Cas constructs U6-gRNA:CMV-eCas9-2a-tRFP (p05 transfection plasmid, Sigma-Aldrich) targeting human SLUG exon2 (target sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... amplified from HUVEC cDNA and cloned in the pcDNA3.1 plasmid (Sigma-Aldrich, #E0648). All constructs were checked by full-length sequencing (Microsynth AG ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Both plasmids carry a gene for antibiotic resistance (Gentamicin 418, Sigma-Aldrich: G418). Vegetative growth was started from frozen aliquots thawed every week to prevent the accumulation of undesired mutations due to prolonged culturing ...
-
bioRxiv - Molecular Biology 2022Quote: ... calcium-phosphate and GenElute HP Plasmid Miniprep kit were acquired from Sigma-Aldrich. ZymoPure Plasmid Midiprep kit and RNA Clean & Concentrator kit were purchased from Zymo Research ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid backbone was additionally treated with FastAP Thermosensitive Alkaline Phosphatase (Sigma Aldrich) after digestion to avoid re-ligation.
-
bioRxiv - Molecular Biology 2022Quote: ... Exonuclease plasmids were transformed into BL21 Rosetta 2(DE3) pLysS E.coli cells (Novagen) for expression ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nucleotide sequence was synthesized by Genscript and cloned into the in vitro transcription/translation plasmid vector pCITE-4a(+) (Novagen), using the NcoI and BamHI sites which adds an S·tag to the amino-terminus and includes a stop codon at the carboxy terminus ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids were then transformed into Rosetta™ 2(DE3)pLysS Competent Cells (Novagen). Single colonies were used to inoculate a 40mL LB overnight starter culture ...
-
bioRxiv - Immunology 2024Quote: ... The pGEX-6-P1-PARP14291–358 plasmid was transformed into BL21(DE3) (Novagen) and selected overnight at 37°C on Luria-Bertani (LB ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant plasmids were transformed into BL21 (DE3) or BL21 (DE3) Tuner cells (Novagen) and were incubated in 1L LB in 2L conical flasks at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... and expression reporter plasmids were cloned using KOD Hot Start DNA Polymerase (Novagen). PCR and digestion products were purified using QIAquick PCR & Gel Cleanup kits (Qiagen) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was obtained from Thermofisher Scientific (Waltham, Massachusetts) and the expression plasmid pET11d from Millipore Sigma (Burlington, Massachusetts).
-
bioRxiv - Immunology 2023Quote: ... commercially available plasmids (pCMV-Cas9-RFP and pCMV-Cas9-GFP) from Sigma-Aldrich was used targeting sequence AATACATACCGTCAGAAGCAGG in exon 3 of EIF2AK2 (PKR ...
-
bioRxiv - Biochemistry 2023Quote: ... The PCR product was subcloned and inserted into a pET-24b (+) plasmid (Novagen) digested with NheI/XhoI placing the gene upstream of a sequence encoding six histidine residues ...