Labshake search
Citations for Millipore Sigma :
2851 - 2900 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’) targeting exon 7 of ERBB2 (cloned by Twin Helix) and selected with puromycin (Sigma-Aldrich) for 4 days (1 μg/ml puromycin for 72 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Cell Biology 2024Quote: C57/BL6 mice at 9 months of age that were administrated with ABT263 or control vehicles at 3 months of age were injected with 5 IU of eCG (Sigma, G4877). The ovaries were collected at 44 hours after the eCG injection ...
-
bioRxiv - Molecular Biology 2023Quote: ... Freshly resected left ventricular tissue (~3-5 mg per sample) was pulled into fibers and permeabilized in the presence of saponin (50 μg/mL, Sigma, 47036) 30 min at 4°C in BIOPS buffer containing the following ...
-
bioRxiv - Microbiology 2023Quote: Cross-linking experiments were performed by incubation of 2 mM and 5 mM of suberic-bis-acid ester (3-sulfo-N-hydroxyuccinimy (BS3, Sigma-Aldrich) with the purified recombinant protein in 25 mM sodium phosphate pH 7.4 for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... 20 mM glucose final concentration; 10 g tryptone [Fisher Bioreagents, BP1421], 5 g yeast extract [Fisher Bioreagents, BP1422], 3 g K2HPO4 [Sigma-Aldrich, P3786] ...
-
bioRxiv - Immunology 2023Quote: ... mice were orally gavaged with 150 μL of an 80 mg/mL solution of 3-5 kDa-FITC-Dextran (Sigma-Aldrich) in PBS ...
-
bioRxiv - Physiology 2023Quote: ... in addition to silent mutations introducing a Mlu1 restriction enzyme recognition site to facilitate genotyping (5’ccacccgtcccctgagcctg aggggctccatgctgagcgtgcttccatccccagccaTTAttTacGCGTagcgcccagcagccatccattgtgccattcaca ccccaggcctacgaggag 3’; capital letters denote the mutated bases) (Sigma Aldrich). The gRNA ...
-
bioRxiv - Cell Biology 2023Quote: The MISSION® pLKO.1-puro Non-Target shRNA (scr) and the shRNA against the UTR of human ZIP11 gene (5’-TCCTGATTGACTCTGATTATA-3’, Cat. TRCN0000434903) were from Sigma-Aldrich. The mammalian gene expression vector pLV[Exp]-EGFP/Neo-Ef1A (pLV ...
-
bioRxiv - Cell Biology 2023Quote: ... Triton-X 100 in PBS with 5 min incubation between each wash and blocked using 3% bovine serum albumin (BSA, A2058, Sigma-Aldrich) in PBS for 1 hr at room temperature ...
-
bioRxiv - Physiology 2023Quote: ... Gene ablation was induced starting at 3 months of age using intra-peritoneal (20 mg/kg per day for 5 days; Sigma #T5648) and then chow-mediated intake (40 mg/kg ...
-
bioRxiv - Neuroscience 2023Quote: ... a sense sequence based on 5’-GCCCTAATCCAGAATCTTGTA-3’ corresponding to nucleotides 2473-2493 of mouse mDia3 (DIAPH2; NM_172493.2; Sigma-Aldrich, Cat# TRCN0000108782) was used to construct f(U6 ...
-
bioRxiv - Plant Biology 2023Quote: ... Flash-frozen plant samples (0.2 g) were ground and extracted using 2 mL of 3 % 5-sulfosalicylic acid (Sigma, ON, Canada). The extract was centrifuged for 10 min at 8050 x g at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: Dissected tumors were washed in PBS and homogenized at room temperature in urea lysis buffer (8 M urea, 40 mM Tris pH 7.6, 5% SDS supplemented with phosphatase inhibitor cocktails 2, 3 (Sigma P5726, P0044)) ...
-
bioRxiv - Immunology 2023Quote: ... in PBS for at least 30 min at 37 °C and permeabilized with PBS containing 0.1 % Triton-X for 5 minutes and blocked with blocking solution (3 % BSA in PBS) at RT for 30 minutes (all reagents from Sigma-Aldrich). Then ...
-
bioRxiv - Cell Biology 2024Quote: ... After 5 h of incubation the culture medium was de-proteinized by adding an equal volume of 3% trichloroacetic acid (Sigma # T6399) and incubation at 50 °C for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... The medium was changed every 3–4 d and enriched with granulocyte-macrophage colony-stimulating factor (5 ng/ml GM-CSF, Sigma-Aldrich). After approximately 14 d at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2024Quote: Incubation chambers were set up to submerge slices in oxygenated (95% O2, 5% CO2) aCSF containing a selection from the following drugs: 3 µM puromycin dihydrochloride (Sigma P8833), 100 µM dopamine hydrochloride (Sigma H8502) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μM T3 (3,3’,5-Triiodo-L-thyronine sodium salt, Sigma), 10 μM ALK5 inhibitor II (Enzo Life Sciences) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg ml-1 lysozyme (Sigma Aldrich, St. Louis, MO,USA) and 50 Uml-1mutanolysin (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... The samples were mixed with the PLA probe (Sigma, 1:5) for 2 h at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... 1 mM 3,3’,5-Triiodo-L-thyronine sodium salt (T3) (Sigma), 0.5 mM LDN ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked in skim milk (5%, for 1 h; Cat. 70166; Sigma) and immunoblotted with indicated antibody ...
-
bioRxiv - Cell Biology 2021Quote: 5 mM HEPES (from 1 M solution, H0887-20ML, Sigma Aldrich)
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-Collapsin Response-Mediated Protein 5 (CRMP5, 1:50, Millipore), mouse anti-γ-tubulin (1:50 ...
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit α-c-Fos (1:750, Millipore PC38, Ab-5 RRID:AB_2314421). After primary antibody incubation and washing 3 times with PBS ...
-
bioRxiv - Genetics 2022Quote: ... 1 nM 3,3’,5-Triiodo-L-thyronine (SIGMA, cat. no. T6397) and 10 mM HEPES (CORNING ...
-
bioRxiv - Biochemistry 2019Quote: ... 5% aqueous sodium thiosulfate for 1 minute (Sigma-Aldrich, S-6672), and then crocein scarlet-acid fuchsin solution for 2 minutes (4 parts crocein scarlet – 0.1% crocein scarlet [Alfa Aesar ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 million cells per condition were fixed in 1% formaldehyde (Sigma) for 10 minutes ...
-
bioRxiv - Bioengineering 2019Quote: ... 500 μl of laminin solution (5 μg ml−1, Sigma-Aldrich) prepared in Neurobasal medium was added to each well and incubated overnight at 37°C (8% CO2) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then for 5 min in 1 µg/ml DAPI (Sigma) PBT ...
-
bioRxiv - Neuroscience 2019Quote: ... monoclonal mouse anti-mouse GFAP (1:2000; Sigma G-A-5), and monoclonal rat anti-mouse IL-6 (1:50 ...
-
bioRxiv - Genetics 2020Quote: ... 5 mL of 1 μM mustard oil (allyl isothiocyanate, Sigma-Aldrich) were added to the dishes with a Pasteur pipette (final concentration 0.66 μM ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg/mL insulin and 1 μg/mL hydrocortisone (Sigma-Aldrich). HCT-116 ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-alpha tubulin mAb (clone B-5-1-2; Sigma-Aldrich) and sheep anti-NGF pAb (EMD Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 μg/ml hydrocortisone and 5 μg/ml insulin (Sigma-Aldrich). All cells were grown in a humidified atmosphere at 37°C with 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... 10% FBS and 1% sodium bicarbonate) and 5 mM ATP (Sigma). Mosquitoes were offered the infectious bloodmeal for 20 min through a membrane feeding system (Hemotek ...
-
bioRxiv - Microbiology 2023Quote: ... or tebuconazole (Sigma-Aldrich, Germany, 2.5, 5 or 10 mg.L-1). We sterilised PDB 2X at 121°C for 15 minutes and inhibitor solutions by filtration at 0.45 μm ...
-
bioRxiv - Cancer Biology 2024Quote: ... TRITC-Dextran (500 kDa, 52194, Sigma Aldrich, 5 mg mL-1) or FITC-Dextran (2000 kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were blocked 1 hour with 5% normal goat serum (Millipore) and 0.2% Triton-X 100 (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 1 unit/μL DNase I (Sigma, AMP D1) and 5 μL of 10 mg/mL RNase A (Thermo ...
-
bioRxiv - Biophysics 2022Quote: ... 1 mM 2-mercaptoethanol) containing 5 μM retinoic acid (Sigma, R2625) and 2 mg/ml doxycycline (TargetMol ...
-
bioRxiv - Immunology 2024Quote: ... they were plated and differentiated in polyornithine (1:5, Sigma-Aldrich)/laminine (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... tissues were incubated for 5 min with DAPI (1:10k) (Sigma), and washed thrice with PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µg of an shRNA vector (pLKO.1-puro vector-Sigma), 2 µg pMD2.g ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were incubated for 5 min with DAPI (1:10,000) (Sigma), and washed three time with PBS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... or potassium hydroxide (KOH, 1 M or 5 M, Sigma-Aldrich) solutions using a bench-top pH meter (pH 210 ...
-
bioRxiv - Immunology 2023Quote: ... 5 mmol/L Sodium pyrophosphate decahydrate (13472-36-1, Sigma Aldrich), 1 mmol/L EDTA (E5134 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were blocked for 1 hour in 5% BSA (Sigma, A3059) in PBS at room temperature before the incubation with primary antibody for 2 hours and fluorophore-labeled secondary antibody for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... DAPI (1:1000 dilution; 5 mg/ml stock solution, Sigma-Aldrich) and Alexa Fluor 488 Phalloidin (1:80 dilution ...