Labshake search
Citations for Millipore Sigma :
2801 - 2850 of 10000+ citations for 6 6 DIMETHYL 4 OXO 4 5 6 7 TETRAHYDRO 1 BENZOFURAN 3 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Labeled viruses were further purified by ultracentrifugation at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient for 1 hour.
-
bioRxiv - Microbiology 2019Quote: ... Cells were prepared in 6-well plates precoated with laminin (10 mg/ml; catalog number L2020; Sigma) and were grown to near confluence (80 to 90% ...
-
bioRxiv - Cancer Biology 2019Quote: ... and used to transduce cells in the presence of 6 μg/mL polybrene (Sigma, St. Louis, MO).
-
bioRxiv - Neuroscience 2020Quote: ... Cells were plated into 6 well plates coated with >300,000 MW Poly D Lysine (PDL; Sigma, P7405). After 7 DIV ...
-
bioRxiv - Cell Biology 2021Quote: NFIC expression was interfered in 266-6 cells using Mission shRNA lentiviral constructs purchased from Sigma-Aldrich. Nfic sh1 [TRCN0000374154 targeting ACAGACAGCCTCCACCTACTT) ...
-
bioRxiv - Genomics 2021Quote: ... we harvested EBs and moved them to an ultra-low attachment 6-well plate (CLS3471-24EA, Sigma) in E6 media (A1516401 ...
-
bioRxiv - Microbiology 2019Quote: ... For each strain 60 µl lysate were incubated with 6 µl amyloglucosidase (200 U/ml, Sigma-Aldrich) (quantification of glucose stored as glycogen and free glucose ...
-
bioRxiv - Molecular Biology 2021Quote: ... Culture medium was changed 6 h after transfection and supplemented with 10 μM 9-cis-retinal (Sigma) for experiments with light-activated receptors ...
-
bioRxiv - Molecular Biology 2021Quote: ... Culture medium was changed 6 h after transfection and supplemented with 10 μM 9-cis-retinal (Sigma) for experiments with light-activated receptors.
-
bioRxiv - Neuroscience 2020Quote: ... followed by 6×10 min washes in PBX (PBS with 0.3% Triton-X 100 [Sigma-Aldrich, T8787]) at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen retrieval was performed by microwaving sections in preheated 0.01 M citrate buffer pH 6 (Sigma Aldrich) for 5 min.
-
bioRxiv - Cell Biology 2020Quote: ... Islets were isolated from 6-12 week old male and female FVB mice using collagenase XI (Sigma) digestion according to a previously published protocol101 ...
-
bioRxiv - Biophysics 2022Quote: ... (6)) by using anti-Flag coupled beads (Pierce, #A36797) for Src precipitation and anti-Flag (M2, Sigma) and anti-Myc (9B11 ...
-
bioRxiv - Immunology 2022Quote: ... as the mobile phase on the Superose 6 Increase 10/300 GL (Millipore Sigma, 29-0915-96). Fractions were analyzed by SDS-PAGE to identify those containing gH/gL >95% purity based on Coomassie blue staining ...
-
bioRxiv - Cell Biology 2022Quote: ... contained in a 6-well plate were coated with poly-D-lysine (50 ng/ml, Sigma, P6407) for 1-2 h at 37°C after which the poly-D-lysine was removed ...
-
bioRxiv - Developmental Biology 2021Quote: ... then dehydrated through a PBS/methanol gradient and bleached with 6% (vol/vol) hydrogen peroxide (H1009, Sigma) in methanol overnight at 4° C ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded in 6-well plate (100,000 to 150,000) and infected in the presence of 8μg/ml polybrene (Sigma). Cells were selected in medium containing 3μg/ml puromycin (Sigma ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 6 μg of female-derived competitive DNA and 50 µg of sonicated salmon sperm DNA (Sigma-Aldrich). Each ethanol-precipitated probe mixture was dissolved in 20 μL of the hybridization buffer (for composition ...
-
bioRxiv - Cancer Biology 2022Quote: ... A methylcellulose stock solution was prepared by dissolving 6 grams of autoclaved methylcellulose powder (M0512 Sigma-Aldrich) into 250 ml of preheated (60°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 weeks old mice in the 4NQO group were given 100ug/ml of 4NQO (Sigma-Aldrich, #N8141), a water soluble chemical carcinogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... native fluorescence was quenched after immunostaining by overnight incubation with methanol containing 6% hydrogen peroxide (H1009, Sigma) at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... adult (6-8-wk-old) Lrig1-CreERT2/+;Apc-flox/+ mice were intraperitoneal-injected with 2mg tamoxifen (Sigma) in corn oil for 3 consecutive days ...
-
bioRxiv - Systems Biology 2019Quote: ... Slides were dried for 6 min and subsequently incubated at room temperature with Wright stain (Sigma-Aldrich) for 8 mins ...
-
bioRxiv - Bioengineering 2020Quote: ... as-synthesized mesoporous silica nanoparticles (AMS-6) were loaded with 20% Dox (Doxorubicin hydrochloride, #D1515, Sigma-Aldrich). Dox diluted in 100% ethanol was added to AMS-6 nanoparticles in a round bottom flask mounted on a rotary evaporator ...
-
bioRxiv - Bioengineering 2020Quote: ... FMN was added in excess (above its solubility limit) (F6750, Sigma-Aldrich: 70% pure, free RbF ≤ 6%) and samples were incubated on ice for at least 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... A549 (ATCC) or HeLa (ATCC) cells were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Trichloroethylene (CAS Number 79-01-6) and other chemicals were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise noted ...
-
bioRxiv - Neuroscience 2020Quote: ... Hamilton syringes with 33 gauge needles were used to deliver 2 µL of 6-OHDA (Sigma-Aldrich, France ...
-
bioRxiv - Neuroscience 2019Quote: Samples were incubated in a blocking solution of 10% DMSO/6% donkey serum (EMD Millipore, Temecula, CA)/0.2% Triton X-100/PBS at 37 °C for 2-3 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... They were then washed and permeabilized 6 x 5mins in PBSTx (PBS plus 0.5% Triton-X (Sigma)) and blocked for 2 hrs room temperature in PBSTx plus 5% goat serum (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... vibratome sections (500 µm) from wild-type (C57BL/6) lungs were stained with rabbit anti-SftpC (Millipore) and Armenian hamster anti-Muc1 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... UFM1 (GCTGTGAAAGGTGTACTTTC) and UFC1 (GTGACAACGATTGGTTCCGAC) followed by selection with 75 µg/ml 6-thioguanine (Sigma-Aldrich, A4882) 4 days after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 6-day-old perithecia with TRI Reagent (Sigma-Aldrich, cat. no. T9424) and re-suspended in 5M urea ...
-
bioRxiv - Immunology 2020Quote: ... T cells were also stimulated for 6 hours with 50ng/ml PMA and 1μg/ml Ionomycin (Sigma). T cells were then harvested ...
-
bioRxiv - Molecular Biology 2021Quote: Melanoma cells treated with ARN22089 for 6 or 24 h and lysed in RIPA buffer (EMD Millipore or an optimized cocktail (250 mM NaCL ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the embryos were treated for 6 days with 0.003% N-phenylthiourea (PTU) (Sigma, St Louis, MO) to inhibit pigment formation.
-
bioRxiv - Genetics 2020Quote: ... cells were permeablised first with 1ml/well (6-well plate) mTESR1 medium with 8μg/ml polybrene (Millipore) for 15 min (37°C) ...
-
bioRxiv - Immunology 2022Quote: ... and digested in 6 ml of 2-mg/mL type II collagenase (Sigma # C6885 or Worthington #LS004177) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Successfully transduced cells were then selected using blasticidin (6 µg/ml, Cat. no. 15205, Sigma-Al- drich). For the experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... fibroblasts were seeded at 2.25×104 into each well of 6 well dishes (Millipore Sigma Cat. CLS3516) in 2ml complete M106 on Day 0 and grown overnight ...
-
bioRxiv - Genetics 2022Quote: ... UMOD-GFP cells were treated for 6 h with 2.5 μM proteasome inhibitor MG132 (M8699, Sigma-Aldrich). Protein samples were collected at 2 ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... the barcode beads were washed three times in 6 x SSC buffer (Sigma, catalog no. S0902-1L) and loaded into Countess (Thermo-Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 weeks aged mice were fed with drinking water containing 50 μg/mL 4NQO (Sigma-Aldrich, N8141) for 16 weeks and then given normal drinking water for additional 10 weeks ...
-
bioRxiv - Neuroscience 2023Quote: ... confluent wells in a 6-well plate were incubated with 20mM NH4Cl (Sigma-Aldrich, St Louis MO) and 300μM leupeptin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-week- old male mice were injected with 25 mg/kg LPS (Sigma Aldrich, St. Louis, MO) or PBS above calvariae ...
-
bioRxiv - Systems Biology 2024Quote: ... 6 - 10 worms were then randomly picked in a drop of 20 mM tetramisole (Cat. T1512, Sigma) and then aligned on an empty NGM plate ...
-
bioRxiv - Systems Biology 2024Quote: ... and reporter cell lines (170,000 cells) were transduced in the presence of 6 µg/ml polybrene (Sigma). Cells were harvested 24 hours later and plated in medium containing 1 µg/ml Puromycin (InvivoGen ...
-
bioRxiv - Developmental Biology 2024Quote: ... fibroblasts were collected and transferred equally to a 6-well plate coated with Matrigel in DMEM (Sigma) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently transduced two times with viral supernatant in the presence of 6 ug/ml polybrene (Sigma) and 50 U/ml IL-2 ...
-
bioRxiv - Neuroscience 2024Quote: ... EAE was induced in C57BL/6 mice by immunization with oligodendrocyte glycoprotein 35–55 (200 μg; Sigma) in incomplete Freund’s adjuvant supplemented with Mycobacterium tuberculosis H37Ra ...