Labshake search
Citations for Millipore Sigma :
2751 - 2800 of 10000+ citations for Vertical Electrophoresis Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Cells were seeded in 8-chamber slides (Millipore) and treated with the indicated drug concentrations ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were exposed to menadione sodium bisulfite (Sigma) or hydrogen peroxide (H2O2 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were permeabilized with ice cold methanol (Sigma), on ice for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Rat adult hippocampal neural stem cells (Sigma SCR022) were cultured in serum free medium (1X KnockOut D-MEM/F-12 with 2% StemPro Neural Supplement (ThermoFisher A1050801) ...
-
bioRxiv - Cancer Biology 2023Quote: ... NB cell lines SK-N-FI (Sigma-Aldrich), SK-N-AS (ATCC) ...
-
bioRxiv - Biophysics 2023Quote: ... cells were stained with calcofluor white (Sigma-Aldrich), which binds chitin within the cell wall ...
-
bioRxiv - Genomics 2023Quote: ... Cells were transfected with GeneJuice Transfection Reagent (Novagen) 24 hours after seeding ...
-
bioRxiv - Systems Biology 2023Quote: ... Cells were split using Accutase solution (Sigma, A6964) and resuspended in prewarmed E8 culture medium supplemented with ROCK inhibitor before transfer to the Matrigel-coated plate ...
-
bioRxiv - Systems Biology 2023Quote: Cells were collected using Accutase solution (Sigma, A6964) when they reached 70% – 80% confluency ...
-
bioRxiv - Genomics 2023Quote: Cells were fixed by adding 37% formaldehyde (Sigma) at a final concentration of 1% and incubating for 15 minutes at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... red blood cell lysed (Hybri-Max, Sigma, R7757), and stained for hCD8 and tumor target antigens ...
-
bioRxiv - Neuroscience 2023Quote: Cells were fixed in 4% paraformaldehyde (Sigma Aldrich) for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were lysed using RIPA buffer (Sigma-Aldrich) containing protease inhibitor cocktail (Protease/Phosphastase inhibitor cocktail ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were stained with trypan blue (Sigma) and microscopically evaluated.
-
bioRxiv - Microbiology 2023Quote: ... cells were treated with 100 uM Cidofovir (Sigma) or 70 ug/mL Phosphonacetic Acid (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and placed on Millicell Cell Culture inserts (Millipore) in 35 mm dishes ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were transfected using polyethylenimine (PEI, Sigma) at a 1:4 DNA:PEI ratio or Lipofectamine 2000 (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... Cells were treated with edaravone (EDV, Sigma, M70800) and dimethyl fumarate (DMF ...
-
bioRxiv - Genomics 2023Quote: ... Cells were lysed in TRI reagent (Sigma-Aldrich) using a Direct-zol RNA MiniPrep kit (Zymo Research) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were fixed with 4% PFA (Sigma, 158127) for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... treated with red blood cells lysis buffer (Sigma), and total viable cells were quantified with trypan blue staining using an automated cell counter (TC-20 Automated Cell Counter ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed with formaldehyde (2%, Sigma #F8775) and permeabilized with 0.3% Triton X-100 in FACS buffer (PBS ...
-
bioRxiv - Immunology 2023Quote: ... U251 glioblastoma cells were purchased from Millipore Sigma and maintained in DMEM supplemented with 10% FCS (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were treated with 100uM 4-thiouridine (Sigma) for 12 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Flag tag (14793, Cell Signaling Technology; F1804, Sigma), Cytokeratin 5 (AB_2538529 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were selected with puromycin dihydrochloride (Sigma-Aldrich, St ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were treated with 10 µM ML385 (Sigma). All treatments and controls contained a final concentration of 0.2% Dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then stimulated with DMSO (Sigma Millipore), PBS (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then stimulated with DMSO (Sigma Millipore), PBS (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... C2C12 cells were seeded on fibronectin (Sigma; F1141) coated glass coverslips at 30% confluency in GM ...
-
bioRxiv - Cell Biology 2023Quote: ... transformed into Rosetta(DE3)pLysS Competent Cells (Novagen). 80 pmol of Alt-R CRISPR-Cas12a crRNA targeting sequence GGATGCTGTGTCCAGCTTATGCTT (IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then fixed in 2.5% Glutaraldehyde (Sigma) in 1X PHEMS buffer overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were stained with propidium iodide (Sigma-Aldrich) and imaged with the ACS_APO 10x/NA 0.30 objective of an inverted confocal microscope (Leica ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were perfused with 2 µM FCCP (Sigma) or 4 µM Ionomycin (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... was transformed into BL21(DE3) Rosetta cells (Novagen). γ-TuNA expression was induced in a 12 L culture with 0.5 mM IPTG for 16 hours at 18°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Isolated bacmids were transfected into Sf9 cells (Novagen) using the Bac-to-Bac system (Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with 500 nM rapamycin (Sigma) for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell nuclei were labelled with DAPI (Sigma Aldrich). 10 independent fields from each section were analyzed by using LSM 710 Zeiss confocal microscope and quantified either using ImageJ or QuPath softwares.
-
bioRxiv - Cell Biology 2023Quote: ... HT-1080 cells were purchased from Sigma-Aldrich. U251 cells were a generous gift from Calibr ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... cells were treated with Hoechst 33342 (Sigma Aldrich) and SytoxGreen (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were exposed to DEX (Sigma-Aldrich) for 2 h to synchronize the expression of clock genes ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were perfused with 2 µM FCCP (Sigma) in glucose-free buffer.
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded subconfluently on fibronectin (F1141; Sigma)-coated (1:100 in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were permeabilized with triton-X100 (Sigma #T8787). Cells were stained for 1h at RT with a monoclonal Anti-HA tag antibody [16B12] (ab130275 ...
-
bioRxiv - Neuroscience 2023Quote: Cells were fixed with 10% Formalin (Sigma Aldrich) for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 using Handheld Automated Cell Counter (Millipore). The growth curve of the two passages was constructed by plotting the log of growth against time and the population doubling time was calculated using standard formula [17].
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1mL RNAzol (Sigma-Aldrich), and samples were stored at −80°C ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were washed with PBS (Sigma-Aldrich), fixed with 2% paraformaldehyde (Electron Microscopy Sciences)/ 0.5% glutaraldehyde (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... B cells were stimulated with 3mM CpG (Sigma), in 96 well flat-bottom plates at 104 cells per well.
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were lysed in TRI Reagent (Sigma- Aldrich) according to manufacturer’s instruction and immediately stored at -80 °C ...