Labshake search
Citations for Millipore Sigma :
2601 - 2650 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated during the 3 days chase period with the following compounds: Bafilomycin A1 (5-10 nM; Sigma-Aldrich), Rab7 inhibitor (CID 1067700 ...
-
bioRxiv - Microbiology 2020Quote: ... 5 days post fertilization (dpf) zebrafish larvae were anaesthetized with 0.017% Ethyl 3-aminobenzoate methanesulfonate (MS-222, Tricaine, Sigma-Aldrich) in egg water ...
-
bioRxiv - Cell Biology 2021Quote: Oligonucleotides containing the sequence 5’-TGCATGTTCTCACTGCTCCTTTACTAGCAAATACAACAGAAGACAAACCTAGTAA AGATGATTTTCAGACTGCCCAACTATTGGCACTTGTATTGGAATTGTTAACATTTT GTGTGGAGCACCATACCTACCACATAAAGAACTACATTATTAATAAGGATATCCT CCGGAGAGTGCTAGTTCTTATGGCCTCGAAGCATGCTTTCTTGGCATTATGTGCC CTTCGTTTTAAAAGAAAGATTATTGGATTAAAAGATGAGTTTTACAACCGCTACA TAATGAAAAGTTTTTTGTTTGAACCAGTAGTGAAAGCATTTCTCAACAATGGATC CCGCTACAATCTGATGAACTCTGCCATAATAGAGATGTTTGAATTTATTAGAGTG GAAGATATAAAATCATTAACTGCTCATGTAATTGAAAATTACTGGAAAGCACTG GAAGATG-3’ were used (Mission esiRNA, Sigma) and transfected into cells using Lipofectamine 2000 reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Confluent ESCs monolayers were decidualized in DMEM/F12 containing 2 % FBS supplemented with 0.3 mM N6,2′-O-Dibutyryladenosine 3′,5′-cyclic monophosphate sodium salt (cAMP) (Sigma-Aldrich, USA), 10 nM β-Estradiol (E2 ...
-
bioRxiv - Microbiology 2022Quote: ... and the ampicillin media was stained by adding 5 µl and 3 µl of a fluorescent dye (rhodamine, Sigma S1402) in 100ml of media used to grow MG:GT and MG/pBGT cells ...
-
bioRxiv - Genomics 2022Quote: ... 75μl of a mix of the 16S probe (5’-GGATTAGATACCCBDGTAGTCGAGATNBAAAAAAAAAAAAAAAAAAAA-3’, IDT, USA) at 0.6μM concentration with 4X Saline Sodium Citrate (SSC) (SSC, Sigma-Aldrich, USA) and 0.1% SDS (Sigma-Aldrich ...
-
bioRxiv - Physiology 2022Quote: Pancreata were injected through the portal vein with 3-5 mL cold Hanks buffer containing 0.95 mg/mL collagenase V (Sigma, USA). The collected pancreata were incubated at 37°C for 7 min ...
-
bioRxiv - Neuroscience 2022Quote: Fly heads from 5 flies (3 samples collected per genotype) were homogenized using a motorized pestle and 50 μL RIPA buffer (Sigma) containing protease and phosphatase inhibitors (cOmplete and PhosStop ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418; Sigma). The culture was incubated with shaking (120 rpm ...
-
bioRxiv - Molecular Biology 2023Quote: Cytotoxicity of Quercetin and other natural compounds was evaluated using MTT (3-(4, 5- dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide dye) assay (Sigma Aldrich). Following the drug treatment in triplicate at indicated concentrations ...
-
bioRxiv - Neuroscience 2022Quote: ... and then washed with PB (3 × 5 min; RT) and finally mounted on gelatinised slides and coverslipped with Mowiol DABCO (Sigma). For brightfield microscopy ...
-
bioRxiv - Cell Biology 2024Quote: ... The flat mount was then rinsed with HBSS and incubated in blocking buffer made with HBSS with 5% bovine serum albumin (Catalog #BP9703-100) (W/V) and 3% Triton X-100 (Sigma) (V/V ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with U6-gDNA (5’-AAAGACGTCCCTAACAAGT-3’; clone ID es: HSPD0000063884): CMV-eCas9-2a-tGFP (Sigma-Aldrich). 48h after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were cultured in 0.4 µm or 3.0 µm pored Transwell inserts and fluorescein isothiocyanate (FITC)-conjugated dextran molecules of 3– 5 kDa or 150 kDa (Sigma) were added at 0.5 mg/ml to the top chamber of the Transwell insert for 24 h ...
-
bioRxiv - Developmental Biology 2024Quote: ... All antibody incubations were done in block solution containing 5-10% Normal Donkey serum and 3% Bovine Serum Albumin (BSA, Sigma). After early initial staining ...
-
bioRxiv - Genetics 2024Quote: ... differentiation of iPSCs was induced through the Wnt modulation method with 7 μM glycogen synthase kinase 3 b (GSK3b) inhibitor CHIR99021 (Selleckchem) and 5 μM inhibitor of WNT production 2 (IWP2) (Sigma). Basal Media was composed of RPMI media supplemented with B27 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... 20 μg cell proteins or 3-5 μg EVs proteins were denatured in LDS sample buffer containing 1M Dithiothreitol (DTT, Sigma) for 10 min at 70°C and loaded onto a 4-12% precast polyacrylamide gels for electrophoresis ...
-
bioRxiv - Developmental Biology 2024Quote: ... the samples were incubated in NBT (nitro-tetrazolium blue)-BCIP (5 bromo-4-chloro-3’-indolyphosphate p-toluidine) (Sigma-Aldrich), 0.033% in APTMg in dark condition ...
-
bioRxiv - Cell Biology 2023Quote: ... blots were again washed 3 times (5 min per wash in Tween-20 saline) before addition of ECL (Millipore, MA) for chemiluminescent detection on a BioRad Image Analyzer using Image Lab to capture and quantify signal intensity ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were subsequently washed 3 × 5 min in 1x TBS/ 0.1% Tween-20 and developed using Immobilon Western HRP Substrate (Millipore, WBKLS0S00) and imaged using the Azure C300 ...
-
bioRxiv - Neuroscience 2023Quote: ... free-floating sections were first washed in TBS (3 washes for 5 min each) and then treated with 0.25% H2O2 (Cat#216763, Sigma-Aldrich), in TBS for 3 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Azo biotin-azide (CAS No. 1339202-33-3) and Imatinib (Cas No.152459-95-5) were obtained from Sigma Aldrich, rapamycin (Cas No.53123-88-9 ...
-
bioRxiv - Biochemistry 2023Quote: ... The slides were washed again carefully with PBS 3 x 5 mins and the coverslips were mounted onto glass microscope slides with Fluoroshield with DAPI (Sigma) and sealed with clear nail varnish ...
-
bioRxiv - Pathology 2023Quote: ... Nuclear fast red solution was prepared using 0.1 g nuclear fast red powder in 100 mL distilled water with 5 g Al2(SO4)3 (Sigma-Aldrich). Deparaffinized slides were washed with distilled water and then incubated with the Alcian blue solution for 30 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed 3 times for 5 min in PBS and blocked with 3% BSA in PBS-Triton 0.01% (Triton X-100, Sigma, T8787) for 1h ...
-
bioRxiv - Bioengineering 2023Quote: ... 3 µL of 2 M CaCl2 and 5 µL of 10 mg/mL ε-aminocaproic acid (ε-ACA) (Sigma-Aldrich), and 1 µL of 1U/µL Thrombin (MP Biomedicals ...
-
bioRxiv - Immunology 2023Quote: ... mice were fasted for four hours before oral gavage of 600 mg/kg FITC–3-5-kDa dextran (Sigma, FD4). Serum was collected six hours after gavage as well as control mice without gavage and analyzed using a Synergy HT plate reader (Bio-Tek ...
-
bioRxiv - Developmental Biology 2023Quote: ... The growth medium of organoids was supplemented with 100μM with 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (8-Br-cAMP) (Sigma, #B7880) in iPSC organoids or 200μM forskolin (FSK ...
-
bioRxiv - Microbiology 2023Quote: ... Protein was then eluted off the agarose by resuspension in 100 µL of 3X FLAG elution buffer (3 µL of 5 mg/mL Sigma 3X FLAG peptide solution + 97 µL of coIP buffer 2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were again washed 3 × 5 min with PBS + 0.1% Tween 20 and incubated with Classico/Crescendo Western HRP substrate (Millipore-Sigma) for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the brains were dissected to 2 mm slices and incubated for 10 minutes in freshly prepared 0.5% TTC solution (2, 3, 5-Triphenyltetrazolium chloride, Sigma-Aldrich). Afterward ...
-
bioRxiv - Cancer Biology 2023Quote: ... two to four-month-old mice were gavaged 3 times over 5 days with 2 mg tamoxifen (TX; Sigma #T5648) in corn oil (Sigma #C8267) ...
-
bioRxiv - Microbiology 2023Quote: The synthetic positive control had the sequence: 5’ – TCCTAAAGCACCACGCAGCATCTATCGCGAGCTTAATCACCATGCCGCGTCCAACGCGATCCCCGCTCGGCAGGGATC CCTCTTCTCGCACCGGGCCACAATCCACTGGGGTCGCTATGA – 3’ and was synthesised as an ssDNA oligo (Sigma-Aldrich). The synthesised IS2404 synthetic positive was resuspended in nuclease-free water and diluted to 0.001 pM ...
-
bioRxiv - Microbiology 2023Quote: ... the blots were washed again using TBST and developed using AP-reactive Nitrobluetetrazolium (NBT) 5-bromo-4-chloro-3-indolylphosphate (BCIP) tablets (Sigma). A final image of the blots was taken on a Bio-Rad ChemiDoc gel imaging system using colorimetric detection.
-
bioRxiv - Cell Biology 2023Quote: ... cells were cultured in 0.4 μm or 3.0 μm pored Transwell inserts and fluorescein isothiocyanate (FITC)-conjugated dextran molecules of 3–5 kDa or 150 kDa (Sigma) were added at 0.5 mg/ml to the top chamber of the Transwell inserts as we previously described41 ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mL of each sample was injected onto a ZIC-pHILIC 2.1 3 150 mm (5 mm particle size) column (EMD Millipore). Buffer A was 20 mM ammonium carbonate ...
-
bioRxiv - Plant Biology 2024Quote: ... AGPs were finally detected using the following substrates: 4 mg of 5-bromo-4-chloro-3-indolylphosphate (BCiP; Sigma, USA) in 1 mL water and 9 mg of nitro-blue tetrazolium (NBT ...
-
bioRxiv - Genetics 2024Quote: ... and 3-5 µl plasmid solution (Plasmid concentration 100-200 ng/µl) containing Phenol Red for visualization (0.1% Sigma #P0290) was injected intramuscularly using a Nanofil syringe (WPI ...
-
bioRxiv - Genomics 2024Quote: ... followed by TBST washes (3 x 5 min) and then counterstaining with DAPI (20µg/ml in TBST, D9542, Sigma Aldrich). Slides were then mounted using an antifade reagent composed of 10% v/v Mowiol 4 to 88 ...
-
bioRxiv - Biophysics 2024Quote: ... The PDMS scaffold surface was activated by oxygen plasma and then treated with a 5% (3-aminopropyl) triethoxysilane (Sigma-Aldrich) solution in methanol for 45 min ...
-
bioRxiv - Cell Biology 2024Quote: ... the coverslips were washed 3 times for 5 min with PBST and mounted on microscope slides using Mowiol (EMD Millipore) as the mounting agent ...
-
bioRxiv - Microbiology 2024Quote: ... mice were intranasally administered with 3 µg of the RSP protein and 5 μg of cholera toxin (CT; Sigma-Aldrich) as immunological adjuvant ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 minutes and washed 3-4 times in PBS before being mounted in Mowiol mounting media (Millipore, 475904-M).
-
bioRxiv - Bioengineering 2024Quote: ... or 3-5×105 pelleted cells were lysed in TRI Reagent (“LS” for fluid EV samples, conventional for cells, Merck Millipore). Liquid chloroform was added to the lysates at a 1:5 v/v ratio and vigorously mixed for 30 s ...
-
bioRxiv - Cell Biology 2024Quote: ... Moreover, a non-targeting control siRNA (NT siRNA, or siCON) with the sequence 5’-CGUACUGCUUGCGAUACGGUU-3’ was used (Sigma-Aldrich). Cells were transfected with 22 pmol of siRNA oligonucleotides/well using Lipofectamine RNAiMAX (ThermoFisher Scientifc ...
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma, Burlington ...
-
bioRxiv - Microbiology 2024Quote: ... 10 min) and resuspended in 3-5 ml lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 0.5xCellLytic B [Sigma-Aldrich] ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were cultivated under humidified conditions with 5% CO2 at 37°C and passaged every 3-4 days using 0.05% trypsin/EDTA (Sigma-Aldrich). Cells were harvested in ice-cold PBS buffer using a cell scraper ...
-
bioRxiv - Neuroscience 2022Quote: ... SIGMA, #M9942, 1:200), (ki67, BD Pharmingen, #550609, 1:200), (C-caspase 3, Cell-signaling, #9661S, 1:100) (PCNT, SIGMA, #HPA016820, 1:200), (P-Histone H3 ...