Labshake search
Citations for Millipore Sigma :
2551 - 2600 of 10000+ citations for Medium Kit without Serum and with CultureBoost R since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The slides were probed with anti-PfMFS_DTHydrophillic mouse serum (1:100) and anti-PfMSP1 rabbit serum (1:300; Sigma-Aldrich) for 1 hour at RT ...
-
bioRxiv - Physiology 2023Quote: ... Samples were blocked for three hours at room temperature in blocking solution [5% normal goat serum (MP Biochemicals) plus 5% bovine serum albumin (Sigma) in PBST] and then incubated overnight at 4°C in primary antibodies diluted in blocking solution ...
-
bioRxiv - Bioengineering 2023Quote: Scaffolds were fixed in 4% paraformaldehyde for 1 h and incubated in blocking buffer composed of 10% goat serum (MP Bio, Santa Ana, CA) and 10 mg/mL Bovine Serum Albumin (BSA, Sigma) for 30 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich) for 40 minutes at 4 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Blocking solution contained 10% donkey or goat serum in PBS (30 min) and antibodies were diluted in PBS/0.1% Tween20/5% donkey or goat serum (Sigma Aldrich). The following primary antibodies and secondary antibodies were used (staining durations are individually provided) ...
-
bioRxiv - Developmental Biology 2023Quote: ... explants were washed in serum-free IMDM with 0.1% (w/v) bovine serum albumin (BSA, Sigma-Aldrich; St. Louis MO) and incubated for 2-24hrs at 37°C 5% CO2 +/- myristoylated aPKC pseudosubstrate inhibitor (5 μM ...
-
bioRxiv - Microbiology 2023Quote: ... Ultrathin sections of 50 nm were blocked with 5% fetal bovine serum/5% normal goat serum for 30 min and subsequently incubated with rabbit anti-HA antibody (Sigma) for 60 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Tissues were incubated with blocking solution (0.5% Triton X, 2.5% bovine serum albumin [Sigma-Aldrich], 2.5% donkey serum [Sigma-Aldrich]) for one day at 37 °C before being incubated with the primary antibody at 1:500 for 3 days at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were re-suspended in fluorescence-activated cell sorting (FACS) buffer (PBS with 1% fetal calf serum + 0.1% bovine serum albumin; all Sigma Aldrich).
-
bioRxiv - Developmental Biology 2021Quote: ... Eyedrops for dilation or constriction were prepared with (R)-(-)-phenylephrine (Sigma P6126); cyclopentolate (Sigma C-5165) ...
-
bioRxiv - Developmental Biology 2021Quote: ... with BMP4 (1 ng/ml, R&Dsystem) and Thiazovivin (2 microM, Millipore). On day 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50 ng/ml R-Spondin and 2 μM CHIR99021 (Sigma-Aldrich; SML1046).
-
bioRxiv - Developmental Biology 2020Quote: ... with BMP4 (1 ng/ml, R&Dsystem) and Thiazovivin (2 μM, Millipore). On day 1 ...
-
bioRxiv - Genetics 2020Quote: ... bFGF (20 ng/mL, R&D) and Heparin (5 µg/mL, Sigma)) ...
-
bioRxiv - Cancer Biology 2020Quote: Control and Enza-R cells were cultured in media containing DMSO (Sigma) or 50 μM enzalutamide for at least one week ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 ng/ml GDNF (R&D) and 1 mM dibutyryl-cAMP (Sigma), and medium exchanged every 48h ...
-
bioRxiv - Plant Biology 2021Quote: ... resuspended in 1mL of HPLC grade methanol (100%, Sigma, 34860-4L-R), vortexed for 1min ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 µg/mL Laminin (R&D) and 40 µM BrdU (Sigma-Aldrich). On day 4 ...
-
bioRxiv - Molecular Biology 2021Quote: βOHB was (R)-(–)-3-Hydroxybutyric acid sodium salt from Sigma-Aldrich (#298360). Butyrate was Sodium butyrate from Sigma-Aldrich (#303410).
-
bioRxiv - Immunology 2021Quote: ... Recombinant Wnt5A (Cat no.- 10UG 645-WN-010 R & D, GF146 Millipore) and recombinant Wnt3A (Cat no.- 10UG 5036-WN-010 R & D ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gel was stained with 0.25% Coomassie brilliant blue R (Sigma-Aldrich) to identify recombinant proteins ...
-
bioRxiv - Developmental Biology 2024Quote: ... 250 FGF: 250ng/ml FGF4 (R&D) and 250ng/ml Heparin (Sigma); 500 FGF ...
-
bioRxiv - Cancer Biology 2024Quote: ... WNT/R-spondin/Noggin (WRN) containing DMEM/F12 with HEPES (Sigma-Aldrich) containing 20% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... WNT/R-spondin/Noggin (WRN) containing DMEM/F12 with HEPES (Sigma-Aldrich) containing 20% FBS ...
-
bioRxiv - Immunology 2023Quote: ... Slides were incubated in eriochrome cyanine R (Sigma-Aldrich, #3564-18-9) staining solution (0.22% w/v ferric chloride ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 minute incubation in 10% Acetic acid (Sigma-Aldrich, 27225-1L-R), 2 washes with dH20 ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR targeting sequences for ACC1 (F: GGCTTGCACCTAGTAAAGCA, R: TGCTTTACTAGGTGCAAGCC) obtained from Sigma were cloned into the pSpCas9(BB)-2A-GFP bacterial plasmid sourced from Addgene (PX458 ...
-
bioRxiv - Neuroscience 2023Quote: ... and raclopride L-tartrate at 1 mg/kg (Sigma, R-121, Canada) were also used at selected high doses known to reduce locomotion in the open field 89–91 ...
-
bioRxiv - Microbiology 2023Quote: ... 10 mg/mL of poly[(R)-3-hydroxybutyric acid] (Sigma-Aldrich, USA) was used as a PHB standard ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 minute incubation in 10% Acetic acid (Sigma-Aldrich, 27225-1L-R), 2 washes with dH20 ...
-
bioRxiv - Immunology 2023Quote: ... Removed thymi were directly moved to HypoThermosol(R)(Sigma-adrich H4416-100ML), shipped by courier with ice packs and processed in under 24 h post surgery ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and gels were stained with Coomassie Brilliant Blue R-250 (Sigma Chemicals). In both gels ...
-
bioRxiv - Microbiology 2023Quote: ... which consist of a sterilized mixture of RPMI-1640 (Sigma R-0883), HEPES buffer (1 M) ...
-
bioRxiv - Plant Biology 2024Quote: ... The gel was stained by Coomassie brilliant blue R- 250 (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2020Quote: ... cells were cultured in OM with or without 10μM SP600125 for 7 or 14 days and tested by ARS staining (Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... were applied to cells in Tyrode’s solution in the presence or absence of calcium and with or without preincubation for 30 min with 100 µM Tranilast (Millipore). For experiments with Ca2+-free solution ...
-
bioRxiv - Microbiology 2019Quote: ... DNA encoding the POTRA domains (1-4) of BamA with a C-terminal strep-tag (but without the signal sequence) was cloned in pET21a (Novagen). All the proteins above were overexpressed in BL21(DE3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10-fold serially diluted and spotted onto SC-TRP plates with or without the indicated amounts of hydroxyurea (HU) (Sigma), methyl methanesufonate (MMS ...
-
bioRxiv - Molecular Biology 2021Quote: BF PolIE RNAi cells were grown with or without doxycycline for 24 hours then incubated with 2 mM of ethylmethanesulfonate (EMS; Sigma) or DMSO (vehicle ...
-
bioRxiv - Immunology 2021Quote: ... 1-2 x 106 mononuclear cells isolated from blood or tonsil samples were cultured in a round bottom 96 well plate at 37°C 5% CO2 in R10 media for 6 hours with or without 200 ng/ml phorbol myristate acetate (PMA) and 1.0 μg/ml Ionomycin (Sigma-Aldrich) or 0.5 μM/ml 5-amino-6-D-ribitylaminouracil (5-A-RU ...
-
bioRxiv - Molecular Biology 2021Quote: ... were plated onto 10 cm cell culture dishes at densities of 4×106 cells and incubated with or without PR inhibitor (10 μM Lopinavir, Sigma). HIV production was activated by adding Vorinostat (10 μM ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Cells were recovered for 1 hour in YPD prior to dividing the culture into 5 aliquots of 200 µL and plating on yeast nitrogen base plus amino acids without uracil (Sigma).
-
bioRxiv - Neuroscience 2019Quote: ... mononuclear cells (1×106 cells/mL) were cultured for 6 h with or without phorbol 12-myristate 13-acetate (PMA, 50ng/mL; Sigma), ionomycin (50ng/mL ...
-
bioRxiv - Biochemistry 2019Quote: ... which was selected on uracil-deficient agar (1.39 g/L Yeast Synthetic Drop-out Media Supplements without uracil (Sigma-Aldrich), 6.7 g/L Yeast Nitrogen Base (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2019Quote: ... A single colony of BJ5464-NpgA-EcPKS1 was used to inoculate uracil-deficient broth (5 mL; 1.39 g/L Yeast Synthetic Drop-out Media Supplements without uracil (Sigma-Aldrich), 6.7 g/L Yeast Nitrogen Base (Sigma-Aldrich) ...
-
bioRxiv - Pathology 2019Quote: ... The eggs were cleaned after 24hr and placed into Ringers solution (Zebrafish Book Protocols) with or without Phenylthiourea (Sigma Aldrich) if pigmented ...
-
bioRxiv - Microbiology 2019Quote: The genes of either E protein or E DIII protein (residues 301-403) of ZIKV (GZ01, KU820898) without tag were cloned into pET28a vectors (Novagen) and expressed by IPTG-induction in BL21 (RIL ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Promoter and terminator characterization experiments were conducted in synthetic media containing 0.67% (w/v) Yeast Nitrogen Base Without Amino Acids (Sigma-Aldrich), 2% Glucose (Fisher Scientific) ...
-
bioRxiv - Biophysics 2019Quote: ... was incubated with or without the C18T/C78A/C108S/C110S variant (100 μM) and PEG(5000)-maleimide (500 μM) (Sigma) in standard sample buffer at 37 °C in the absence of any oxidizing agent ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were inoculated into 200 ml MGY liquid media composed of 1.34% yeast nitrogen base without amino acids (SIGMA Y0626), 0.4 mg/L biotin and 1% glycerol and cultured at 30°C ...