Labshake search
Citations for Millipore Sigma :
2451 - 2500 of 10000+ citations for Estrone 3 Sulfate E1S ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Mouse anti-GAPDH antibody was used at a 1:2000 dilution with TBST containing 3% BSA (Sigma), and other primary antibodies were used at a 1:1000 dilution ...
-
bioRxiv - Cancer Biology 2024Quote: OVCAR-3 cells were treated with s-p-Bromobenzylglutathione cyclopentyl diester (Glo-1 inhibitor) (SML1306, Sigma-Aldrich) for 72 h.
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3-uncoupled (3U) after sequential addition of 3 mM ADP (Sigma-Aldrich A5285), 4 μM oligomycin (Sigma-Aldrich C75351) ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted with Cas1-2/3 Lysis Buffer containing 3 mM desthiobiotin (Sigma-Aldrich). Eluate was concentrated at 4°C (Corning Spin-X concentrators) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (3) 3 hrs at RT in 0.1% Direct Red 23 (212490, Sigma-Aldrich), in PBST ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-α-adducin phospho S355 antibody (Abmart 20592-1NB-3/C63-S, 1:100, for WB and double transgenics) anti-FLAG antibody (M2, F3165, Sigma-Aldrich 1:100). Myosin Light Chain 2 antibody (ptglab ...
-
bioRxiv - Cell Biology 2022Quote: ... the medium was exchanged with 50 μL of fresh medium with 1 mM 3-isobutyl-1-methylxanthine (IBMX) (Sigma-Aldrich, Cat# I7018-100MG), and cells were incubated at 37°C for an additional 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Membranes were incubated overnight in primary antibody diluted in blocking buffer (1:1000 anti-cleaved caspase-3 Cell Signaling Technologies #9664, 1:4000 anti-α-Tubulin Sigma #T5168 ...
-
bioRxiv - Neuroscience 2022Quote: ... CAS# 83-34-1), indole (98%, CAS# 120-72- 9), and 3-ethylindole (97%, CAS# 1484-19-1) were provided by Sigma-Aldrich (Milwaukee, WI), ACROS Organics (Geel ...
-
bioRxiv - Cell Biology 2024Quote: ... blotted on a polyvinylidene fluoride membrane, and probed using the following primary antibodies: anti-UHRF1 (MBL, D289-3, 1:1000) or anti-TUBLIN (SIGMA, T5168, 1:5000). Following the primary antibody reaction ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Immunology 2020Quote: ... 384-well flat-bottom microtiter plates (Nunc MaxiSorp 384-well plates; Sigma-Aldrich) were coated with 25 μl/well of antigen (1:1 mix of S1 and S2 subunits ...
-
bioRxiv - Cancer Biology 2020Quote: ... in 96-well plates (TPP 96 well tissue culture plates from Sigma-Aldrich) and incubated for 24 h at 37 °C to obtain optimal adherence to the surface ...
-
bioRxiv - Immunology 2020Quote: ... 384-well flat-bottom microtiter plates (Nunc MaxiSorp 384-well plates; Sigma-Aldrich) were coated with 25 μl/well of antigen (1:1 mix of S1 and S2 subunits ...
-
bioRxiv - Cell Biology 2020Quote: ... Nucleoproteins were separated by electrophoresis on 6/12% sodium dodecyl sulfate (SDS) polyacrylamide gels and blotted onto polyvinylidene difluoride (PVDF) membranes (Merck Millipore, Darmstadt, Germany). After blocking for 1 h with 5% bovine serum albumin ...
-
bioRxiv - Cell Biology 2020Quote: ... were incubated with 100 μL pseudotyped particles of each type, together with 50 μM hydroxychloroquine sulfate (HCQ, Cayman, #17911) or 50 μM tetracaine hydrochloride (Sigma-Aldrich, #T7508) for 1 h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: We destroyed LL-HCs in 5dpf wild type larvae by exposing them for two hours to freshly prepared Copper Sulfate (II) solution (Cu++, Sigma # PHR1477-1G) at 10μM in Holtfreiter’s buffer 1X (HB-10 X stock = 30g NaCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... Probes were denatured for 5 min at 95 °C before their addition to the hybridization solution (10% w/v dextran sulfate, Sigma D-6001), 10% v/v deionized formamide (VWR 97062-008) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Uric acid-13C 18O was synthesized from urea-13C 18O (Cambridge Isotopes, Andover, MA; Cat #COLM-4861) and 5,6-diaminouracil sulfate (Sigma-Aldrich; Cat #D15103) according to methods of Cavalieri et al (Cavalieri et al ...
-
bioRxiv - Neuroscience 2022Quote: ... the supernatant was removed and protein concentration was measured by use of a Bicinchoninic acid (BCA) solution (#B9643-1LSigma-aldrich, USA) coupled to copper II sulfate solution (#C2284-25ml, Sigma-aldrich, USA) following the manufacturer’s recommandations ...
-
bioRxiv - Bioengineering 2022Quote: ... free calcein or sulfate ammonium was removed by size exclusion chromatography with Sephacryl® S-500 HR column (Cat. # GE17-0613-10, Sigma-Aldrich). The calcein-loaded azosome was used directly ...
-
bioRxiv - Bioengineering 2022Quote: ... and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (10%) and then transferred onto poly vinylidene fluoride membrane (EMD Millipore, MA, USA). The membranes were blocked in phosphate-buffered saline containing 5% fat-free milk for 2 h ...
-
bioRxiv - Bioengineering 2022Quote: ... we first mixed together all the secondary probes with 10% hybridization buffer with Triton-X (10% formamide, 10% dextran sulfate, 2X SSC, and 0.1% Triton-X (Sigma-Aldrich, T8787-100ML)) to a final ~20nM concentration per probe (range ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral particles were collected after 48 and 72 hours of transfection and used to infect HeLa S3 in the presence of 2 μg/ml protamine sulfate (Sigma-Aldrich, P4505) as coadjutant ...
-
bioRxiv - Microbiology 2020Quote: ... and HA-tagged proteins of samples were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and were transferred to a PVDF membrane (Merck Millipore, Tokyo, Japan). The membrane was incubated with rabbit anti-N antiserum or mouse anti-GFP antibody ...
-
bioRxiv - Neuroscience 2020Quote: ... Hair cells were inactivated by the flushing of 8-10 drops of 100 mg/mL neomycin sulfate (Sigma-Aldrich, St Louis, MO) through the punctured round window membrane whilst aspirating from the apex via a small hand-drilled hole ...
-
bioRxiv - Biochemistry 2021Quote: ... and 0.5% w/v of dextran sulfate sodium salt from Leuconostoc spp. with sizes ranging from 6500 to 10000, Sigma-Aldrich in PBS). The substrate was aliquoted and stored at – 80 °C until required ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... L-ascorbic acid (A0278), ammonium iron (II) sulfate hexahydrate (215406), BSA (A3803), and β-nicotinamide adenine dinucleotide (NAD, N6522) were from Sigma-Aldrich. Tween-20 (10% ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The strains were precultured on Yeast Nitrogen Base (YNB) medium without amino acids and with 5 g/L ammonium sulfate (Sigma-Aldrich Y0626) and 10 g/L glucose ...
-
bioRxiv - Systems Biology 2020Quote: ... separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride membrane (PVDF, Millipore, Bedford, MA, USA). The PVDF membrane was blocked with 5% milk in Tris-buffered saline with Tween-20 (TBST ...
-
bioRxiv - Microbiology 2020Quote: ... The total protein present in another half of supernatant was precipitated by using ammonium sulfate (80%) and dialysis using membrane tubing 2 kDa molecular weight cut-off (MWCO) (Sigma-Aldrich, India).
-
bioRxiv - Molecular Biology 2020Quote: ... The proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes (Immobilon-P transfer membrane, EMD Millipore corporation). After blocking the membranes with Blocking One (Nacalai Tesque ...
-
bioRxiv - Microbiology 2019Quote: ... washed in fresh culturing water and collected in a Petri dish with 50 μg/ml gentamicin sulfate (Sigma, Saint Luis, MO, USA) dissolved in their culturing water (see above) ...
-
bioRxiv - Microbiology 2020Quote: ... NPCs were differentiated and maintained using EFH media (Stemline Neural Stem Cell Media [Sigma Aldrich], EGF [R&D Biosystems], rhFGF basic [R&D Biosystems]. Heparin Sulfate [Sigma Aldrich]). NPCs were dissociated and plated onto Matrigel-coated plates (Corning ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The cultures were then induced in SGDCAA (6.7 g/L YNB without amino acid [VWR #90004-150], 5 g/L ammonium sulfate [Sigma-Aldrich #A4418], 2% galactose [Sigma-Aldrich #G0625] ...
-
bioRxiv - Systems Biology 2022Quote: ... Yeast were transformed as described previously52 with the pHLUM plasmid53 and selected for growth on SD media with inositol (5 g/L ammonium sulfate (Sigma-Aldrich: A4418), 1.7 g/L Yeast Nitrogen base (BD Biosciences ...
-
bioRxiv - Systems Biology 2022Quote: The indicated yeast mutants were cultivated in a 96-well format in SD media (5 g/L ammonium sulfate (Sigma-Aldrich: A4418), 1.7 g/L Yeast Nitrogen base (BD Biosciences ...
-
bioRxiv - Neuroscience 2022Quote: Snap frozen retinal samples from 5 older and 5 young primates from both central macular and peripheral regions were homogenized in 2% sodium dodecyl sulfate (SDS, Sigma Aldrich, UK) with protease inhibitor cocktail (Sigma Aldrich ...
-
Neutralizing gut-derived lipopolysaccharide as a novel therapeutic strategy for severe leptospirosisbioRxiv - Microbiology 2024Quote: ... six-week-old female hamsters were administered antibiotics (ampicillin, 100 mg/kg; metronidazole, 100 mg/kg; neomycin sulfate, 100 mg/kg (Sigma-Aldrich, USA) and vancomycin ...
-
bioRxiv - Microbiology 2024Quote: ... 20-30 μg of protein for each sample was separated by 8-15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes (Millipore, cat# IPVH00010) using Trans-Blot Systems (Bio-rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were extracted from cryopulverized tumors in a buffer containing 5% sodium dodecyl sulfate (SDS) and 100 mM TRIS pH 7.8 supplemented with PhosStop phosphatase inhibitor cocktail (Millipore-Sigma, part# 4906845001). The protein concentration of the lysate was determined using bicinchoninic acid assay (BCA ...
-
bioRxiv - Microbiology 2023Quote: ... and formazan crystals simultaneously solubilized with the addition of 100 µl of a solution containing 10% sodium dodecyl sulfate (SDS; Sigma-Aldrich, 05030) and 0.03% HCl (Supelco ...
-
bioRxiv - Cell Biology 2023Quote: ... and transduced with GFP-expressing lentiviral vectors in the presence of 4 μg/ml protamine sulfate (Sigma-Aldrich, St. Louis, MO, USA).