Labshake search
Citations for Millipore Sigma :
201 - 250 of 7246 citations for Dig 6C SAH 1a b c since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Signal detection was carried with DIG luminescence detection kit (Sigma Aldrich, #11363514910) following manufacturers instruction and signal captured with ChemiDoc (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... worms were incubated with anti-DIG-AP (Roche/Sigma 11093274910, 1:2000), anti-DIG-POD (Roche/Sigma 11207733910 ...
-
bioRxiv - Neuroscience 2024Quote: Anti-DIG Fab fragments conjugated to alkaline phosphatase (Sigma-Aldrich, Cat#: 11093274910) were preabsorbed with octopus embryo powder in 1% DIG buffer in TBST for at least one hour ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM ATP (Sigma Aldrich)] and then incubated with gently sonicated anti-FLAG beads to allow binding for 1 hr at 4°C on a rotator in the presence of oxygen scavenging reagents (5 mg/mL b-D-glucose (Sigma Aldrich), 0.25 mg/mL glucose oxidase (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... in TBST 1X at RT for 1 hour followed by incubation at 4°C overnight with primary antibodies (SYNGAP-1:2K, PA1-046, Thermofisher; b-Actin-1:5K, A2228, Sigma Aldrich). Membranes were washed thrice with TBST (0.1% Tween 20 ...
-
bioRxiv - Neuroscience 2024Quote: ... half of the medium was substituted with a culture medium supplemented with 2% B-27 plus supplement and 5μM of cytosine β-d-arabinofuranoside (Ara-C; Sigma; #C1768). The culture medium was then changed every three days ...
-
bioRxiv - Neuroscience 2023Quote: ... washed with PBS/ Tween20 (buffer B) and then blocked with 1% bovine serum albumin in PBS/Tween20 (buffer C) (Sigma-Aldrich). 50 µL of mouse monoclonal V5B2 or rabbit polyclonal sPrPY226 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were incubated overnight at 4°C with primary antibody (VRK3 #HPA056489 Sigma, B-actine #51255 Cell signaling, Lamin # ab16048 Abcam, H3S10P #05-806 Millipore, H4 #07-108 Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... The insulin-secreting cell line INS-1 (a gift from Professor C. B. Wollheim) was cultured in RPMI-1640 (Sigma Aldrich), supplemented with 10% fetal bovine serum (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... F-actin modulating compounds were added in warm EGM2 to live cells during imaging at 37◦C with 5% CO2 to a final concentration of 1µM Cytochalasin B (Sigma-Aldrich, #C26762), 10µM Y-27632 (Calbiochem ...
-
bioRxiv - Genomics 2024Quote: ... and 19 (clones: C-11, PCK-26, CY-90, KS-1A3, M20, A53-B/A2, C2562, Sigma, St. Louis, MO, USA), mouse IgG1 anti-human CK 19 (clone ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked with 5% skimmed milk in TBST buffer for 1 h and incubated ON at 4°C in 5% skimmed milk/TBST with the following primary antibodies: anti-mouse Map2a+b (Sigma #M1406) 1:500 ...
-
bioRxiv - Biochemistry 2022Quote: ... FSL-B(tri) (Function-Spacer-Lipid with blood group B trisaccharide; Sigma Aldrich) or lactosylceramide (LC ...
-
bioRxiv - Immunology 2023Quote: ... GC-B cells and follicle B cells were stained with Pna-HRP (Sigma) and anti-mouse IgD-BIOT (SouthernBiotech ...
-
Computational and functional characterization of the PI(4,5)P2 binding site of the TRPM3 ion channelbioRxiv - Biophysics 2022Quote: ... then bags of ovaries were surgically collected from and rotated with 0.1-0.3 mg/ml type 1A collagenase (Sigma-Aldrich) at 16 °C overnight in OR2 buffer containing 82.5 mM NaCl ...
-
bioRxiv - Bioengineering 2022Quote: ... Carotids were cut into segments no larger than 1 mm3 and placed into MgCl2 + CaCl2 supplemented PBS with 0.7 mg/ml collagenase type 1A from Clostridium histolyticum (Sigma) and 0.25 mg/ml elastase type III from porcine pancreas (Sigma) ...
-
Impact of light pollution at night on male reproductive success in Japanese medaka (Oryzias latipes)bioRxiv - Zoology 2023Quote: ... The males were distinguished by randomly clipping either the top or bottom corner of the tail fin (supplemental figure 1A) under anesthesia with 0.03% Tricaine methanesulfonate (MS222, Sigma). The behavior of the fish in triads was observed for 1-3 minutes each at three time points in the morning for 5-8 days ...
-
bioRxiv - Developmental Biology 2024Quote: ... Limbs were washed once with PBS solution and homogenized in 500 μL collagenase solution (0.1% collagenase type 1a (C9891; Sigma), 0.1% trypsin ...
-
bioRxiv - Genomics 2021Quote: ... mESCs (J1) were initially cultured in presence of Mitomycin C inactivated mouse embryonic fibroblasts on 0.1% gelatin-coated (Millipore, ES-006-B) 6-well plates in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were embedded in Durcupan resin (20 g component A, 20 g component B, 0.6 g component C, 0.4 g component D; Sigma Canada, Toronto, cat# 44610) overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were next embedded overnight at RT in Durcupan resin (20g component A, 20g component B, 0.6g component C, 0.4g component D; Sigma Canada, Toronto, cat# 44610). The following day ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... human recombinant MAO-A (hMAO-A) and MAO-B (hMAO-B) enzymes (Sigma-Aldrich) were diluted in 50 mM phosphate buffer (final protein amount ...
-
bioRxiv - Microbiology 2022Quote: ... purified bacterial cultures (B. adolescentis and B. fragilis at 107CFU/ml) or putrescine (Sigma) diluted to final concentrations of 33/66/100mM ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated with anti-DIG Fab fragments (1:10,000) (Sigma, St. Louis, MO) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with an anti-DIG FITC-tagged probe (Millipore cat #1120774191) diluted 1:200 in blocking buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... Roche Digoxigenin (DIG)-labeled DNA Molecular Weight Marker III (Millipore Sigma can# 11218603910) was loaded as a marker ...
-
bioRxiv - Genomics 2022Quote: ... mm9) ampli?ed by the PCR DIG Probe Synthesis Kit (Sigma-Aldrich, 11636090910). The hybridized probe was immunodetected with antidigoxigenin Fab fragments conjugated to alkaline phosphatase (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probes were made by using a dig RNA labeling mix (Sigma-Aldrich, #11277073910). Fluorescent probes were created with A555 fluorescent tyramine following publicly available protocols (https://sites.google.com/site/helobdellaprotocols/histology/tsa) ...
-
bioRxiv - Cell Biology 2021Quote: ... Hybridized probes were detected with AP-conjugated anti-DIG antibody (#11093274910, Sigma-Aldrich) and CDP-star (#11685627001 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 15μM DIG-11-dUTP (Digoxigenin-11-dUTP, alkali-labile, Sigma, Cat# 1157315291) in a 1X DNA polymerase reaction buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... The antisense riboprobes were synthesized with DIG RNA Labeling Mixture (Sigma-Aldrich, 11277073910) by PCR amplification using the following primers ...
-
Plastid double-strand RNA transgenes trigger small RNA-based gene silencing of nuclear-encoded genesbioRxiv - Plant Biology 2022Quote: ... The probe for DNA hybridization was synthesized using DIG probe kit (Sigma-Aldrich) and used for overnight hybridization at 55C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were made by using a dig RNA labeling mix (Sigma-Aldrich; #11277073910). Fluorescent probes were created with A555 fluorescent tyramine following publicly available protocols (https://sites.google.com/site/helobdellaprotocols/histology/tsa) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the Wnt3-DIG riboprobe was first detected with NBT/BCIP (Sigma, Roche-11383213001) and the FLUO-labeled riboprobe subsequently detected with Fast Red ...
-
bioRxiv - Genomics 2024Quote: ... Detection was accomplished using the DIG DNA Labeling and Detection Kit (Sigma-Aldrich).
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (L5288 from Sigma), 5µM ...
-
bioRxiv - Genomics 2020Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... and polymyxin B (Sigma-Aldrich), were serially diluted 1 in 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... antifoam B (Sigma, 1:5000), and 40U/mL RNAsin (Promega)) ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5μg/mL Polymyxin B (Sigma) was used as permeabilizing agent in the positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma). Spinner-adapted L929 cells (originally obtained from the Bernard Fields laboratory ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:5000 Antifoam B (Sigma) and lysed by vortexing with acid-washed glass beads for 2 min followed by 2 min on ice for three cycles ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 mM b-mercaptoethanol (Sigma) and 1000 U/mL of LIF (Chemicon) ...
-
bioRxiv - Neuroscience 2021Quote: ... rhodamine B (RhoB; Sigma Aldrich), Rp-8-Br-PET-cGMPS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by pestle B (Sigma), and filtered through a 70-um cell strainer (Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Amphotericin B (all Sigma-Aldrich), and BD Difco™ BBL™ Middlebrook ADC Enrichment and incubated at 37 °C with agitation with a magnetic stir bar ...
-
bioRxiv - Microbiology 2020Quote: ... Polymyxin B nonapeptide (PMBN; Sigma), a non-toxic polymyxin derivative ...
-
bioRxiv - Cell Biology 2021Quote: ... Rhodamine B solution (Sigma, 02558) was diluted to 10% in water and image stacks were acquired in the red channel during laser application ...