Labshake search
Citations for Millipore Sigma :
201 - 250 of 10000+ citations for Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3G APOBEC3G Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: mRNA was purified from total RNA with 2 rounds of GeneElute mRNA purification kit (Sigma). rRNA was removed using Ribominus kit (Invitrogen ...
-
bioRxiv - Biochemistry 2022Quote: ... FSL-B(tri) (Function-Spacer-Lipid with blood group B trisaccharide; Sigma Aldrich) or lactosylceramide (LC ...
-
bioRxiv - Immunology 2023Quote: ... GC-B cells and follicle B cells were stained with Pna-HRP (Sigma) and anti-mouse IgD-BIOT (SouthernBiotech ...
-
Mutation in the matricellular gene fibulin-4 leads to endothelial dysfunction in resistance arteriesbioRxiv - Physiology 2022Quote: ... Loading controls were determined using mouse anti-B-actin antibody (1:4,000, Sigma-Aldrich, St. Louis, MO), goat anti-mouse IgG-HRP (1:20,000 ...
-
bioRxiv - Microbiology 2021Quote: ... Rhodamine B isothiocyanate-Dextran (RITC-Dextran) and anti-GFP antibody were purchased from Sigma-Aldrich (Missouri, USA). The anti-HA 16B12 monoclonal mouse antibody was purchased from Biolegend (San Diego ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibody (Mouse Anti-Influenza A NP, Millipore MAB8251 or Mouse Anti-Influenza B NP, Millipore MAB8661) was diluted 1:4000 in antibody diluent ...
-
bioRxiv - Cell Biology 2022Quote: Knockdown of DYNC1H1 subunit of dynein was achieved by using mission® esiRNA from Sigma (EHU059651). The esiRNA was prepared according to the manufacturer’s instructions and the cells were transfected with the esiRNA pool with Hiperfect (Qiagen) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The 50S subunit sample was then concentrated using a 100 kDa cut-off spin filter (Millipore) and washed with buffer A-1 ...
-
bioRxiv - Immunology 2020Quote: ... and poly(A)+ mRNA was enriched from total RNA with GenElute mRNA Miniprep Kit (Sigma-Aldrich). The cDNA was reverse transcribed using M-MLV reverse transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 2U of HMGCR enzyme (Sigma H7039) and 2U of glucose-6 phosphate dehydrogenase (Sigma G6378 ...
-
bioRxiv - Genomics 2019Quote: ... Lysing enzymes from Trichoderma harzianum (Sigma) and Zymolyase-20T (MP Biomedicals ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mg/mL lysing enzyme (Sigma), 1% β-mercaptoethanol ...
-
bioRxiv - Pathology 2019Quote: ... or K (0.05 μL) enzyme (Sigma), and samples were placed at 37°C in a water bath for 15 minutes ...
-
Transient upregulation of translational efficiency in prodromal Tg2576 mice precipitates AD symptomsbioRxiv - Neuroscience 2019Quote: ... β-secretase enzyme-1 (BACE-1, Millipore)
-
bioRxiv - Microbiology 2020Quote: ... β-Glucuronidase enzyme (Sigma: Helix pomatia) was used ...
-
bioRxiv - Bioengineering 2021Quote: ... All coupling enzymes were from Sigma. A reaction buffer was prepared with 0.05 – 0.2µM of ACS ...
-
bioRxiv - Molecular Biology 2022Quote: ... 250U Pyranose Oxidase enzyme (Sigma P4234) was added to 1.25 ml of enzyme storage buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1:200 benzonase nuclease enzyme (Sigma)) for 15 min at 37°C.
-
bioRxiv - Bioengineering 2023Quote: ... eCas9 enzyme (Sigma Aldrich #ESPCAS9PRO-50UG), or dCas9 enzyme (IDT Alt-R® S.p ...
-
bioRxiv - Bioengineering 2023Quote: ... Cas9 enzyme (Sigma Aldrich, #CAS9PROT-250UG), eCas9 enzyme (Sigma Aldrich #ESPCAS9PRO-50UG) ...
-
bioRxiv - Microbiology 2023Quote: ... 270µM Co-enzyme A (C3019, Sigma), 530µM ATP (A7699 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and liberase enzymes (Sigma Aldrich #5401119001). Single cell suspensions of each organ was incubated with antibodies (Table 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.6 mg/mL lysing enzymes (Sigma), 350 µL beta-glucuronidase (MP Biomedicals ...
-
bioRxiv - Cancer Biology 2021Quote: ... A mixtures of Cas9-mRNA (Sigma)(50ng/μL) ...
-
bioRxiv - Immunology 2022Quote: ... mRNA was purified by cellulose (Sigma) purification ...
-
bioRxiv - Microbiology 2022Quote: ... purified bacterial cultures (B. adolescentis and B. fragilis at 107CFU/ml) or putrescine (Sigma) diluted to final concentrations of 33/66/100mM ...
-
bioRxiv - Immunology 2021Quote: ... shCASP8-B (Sigma SHCLND, TRCN0000376481): GGAGCTGCTCTTCCGAATTAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.540g B glycerophosphate (Sigma G9422), 0.092g Na3VO4 (Sigma 450243) ...
-
bioRxiv - Cell Biology 2022Quote: ... Latrunculin B (L5288 from Sigma), 5µM ...
-
bioRxiv - Genomics 2019Quote: ... and B-actin (A5441, Sigma) were used at dilution 1:1000 and 1:5000 ...
-
bioRxiv - Genomics 2020Quote: ... 0.1mM b-mercaptoethanol (Sigma-Aldrich), 2mM L-glutamine (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... amphotericin B (Sigma - Aldrich, Germany) (from 0.125 to 16 µg/mL) ...
-
bioRxiv - Cell Biology 2019Quote: ... Latrunculin B (Sigma, 5 µM) was added to the culture media for 10 min before 20 min of rapamycin ...
-
bioRxiv - Microbiology 2021Quote: ... and polymyxin B (Sigma-Aldrich), were serially diluted 1 in 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... antifoam B (Sigma, 1:5000), and 40U/mL RNAsin (Promega)) ...
-
bioRxiv - Microbiology 2021Quote: ... 2.5μg/mL Polymyxin B (Sigma) was used as permeabilizing agent in the positive control ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.1% amphotericin B (Sigma). Spinner-adapted L929 cells (originally obtained from the Bernard Fields laboratory ...
-
bioRxiv - Cell Biology 2020Quote: ... 1:5000 Antifoam B (Sigma) and lysed by vortexing with acid-washed glass beads for 2 min followed by 2 min on ice for three cycles ...
-
bioRxiv - Genomics 2022Quote: ... 0.1 mM b-mercaptoethanol (Sigma) and 1000 U/mL of LIF (Chemicon) ...
-
bioRxiv - Neuroscience 2021Quote: ... rhodamine B (RhoB; Sigma Aldrich), Rp-8-Br-PET-cGMPS ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by pestle B (Sigma), and filtered through a 70-um cell strainer (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... b-actin (Sigma, AC-15), P-eIF2a (Abcam ...
-
bioRxiv - Developmental Biology 2019Quote: ... 200 nM b-mercaptoethanol (Sigma), 1 % sodium pyruvate (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... B-Actin (A1978; Sigma-Aldrich).
-
bioRxiv - Immunology 2020Quote: ... Amphotericin B (all Sigma-Aldrich), and BD Difco™ BBL™ Middlebrook ADC Enrichment and incubated at 37 °C with agitation with a magnetic stir bar ...
-
bioRxiv - Microbiology 2019Quote: As hygromycin B (Sigma-Aldrich) was used as the selection marker during transformations ...
-
bioRxiv - Microbiology 2020Quote: ... Polymyxin B nonapeptide (PMBN; Sigma), a non-toxic polymyxin derivative ...
-
bioRxiv - Cell Biology 2021Quote: ... Rhodamine B solution (Sigma, 02558) was diluted to 10% in water and image stacks were acquired in the red channel during laser application ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amphotericin B (Sigma, Cat#:A2942) at 250µg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... and B-ACTIN (Sigma A5441).