Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3G APOBEC3G Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: ... 50 μM of cytochalasin B (Sigma C6762) for 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... muscimol and baclofen (M& B; Sigma-Aldrich) respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... 2.5 μg/mL amphotericin B (Sigma-Aldrich), and 100 µM non-essential amino acids (NEAA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Polymyxin B (Sigma-Aldrich, St. Louis, MO), acetonitrile ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 4μg/ml hygromycin B (Millipore Sigma) at 37°C in 5% CO2 and passaged every 3 to 4 days ...
-
bioRxiv - Cancer Biology 2021Quote: ... GSKJ4 (KDM6A/B inhibitor, Sigma, Ref: SML0701), GSKJ5 (GSK-J4 inactive isomer ...
-
bioRxiv - Bioengineering 2020Quote: ... and Sudan Black B (SBB, Sigma-Aldrich) staining for lipofuscin as previously described [100,101] ...
-
bioRxiv - Cell Biology 2021Quote: ... 250 μg/L Amphotericin B (Sigma Aldrich), 50 U/mL penicillin (Mediatech ...
-
bioRxiv - Molecular Biology 2022Quote: ... 25 μM cytochalasin B (ethanol, Sigma Aldrich) was added to the wells before addition of 2-[3H]deoxyglucose (2DG ...
-
bioRxiv - Developmental Biology 2022Quote: ... 15% FBS (ES-009-B, Sigma-Aldrich), penicillin–streptomycin (15140122 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse b-actin (Millipore, 1:20,000). Secondary antibodies were anti-rabbit-HRP (Cell Signaling Technology ...
-
bioRxiv - Immunology 2022Quote: ... anti-α-tubulin (B-5) from Sigma and secondary antibodies goat anti-mouse and anti-rabbit from Li-Cor Biotechnology.
-
bioRxiv - Molecular Biology 2022Quote: ... or Hygromycin B (0.3 mg/ml, Sigma) plates ...
-
bioRxiv - Immunology 2022Quote: ... FCCP (20μM, 22μL port B; Sigma C2920), and Rotenone/Antimycin-A (5μM ...
-
bioRxiv - Immunology 2022Quote: ... Oligomycin (20μM, 22μL port B; Sigma 75351), and 2-Deoxyglucose (500mM ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5 μg/mL Amphotericin B (Sigma Aldrich) and 0.26% sodium bicarbonate (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.5 μg/mL Amphotericin B (Sigma Aldrich) and 0.26% sodium bicarbonate (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... In experiments involving polymyxin B (SIGMA, USA), cell cultures were previously treated with 50 μg/ml of this compound for one hour ...
-
bioRxiv - Microbiology 2020Quote: ... Twenty μl antifoam B emulsion (Sigma Aldrich) was added to prevent the generation of bubbles and foam due to the swirling motion of the collection medium during air sampling.
-
bioRxiv - Microbiology 2020Quote: ... 10 MU polymyxin B sulphate (Sigma Aldrich), 5 MU nystatin (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 mM b-glycerophosphate (all from Sigma) and protease inhibitor cocktail tablet (complete Mini ...
-
bioRxiv - Molecular Biology 2020Quote: ... and B-tubulin III (Sigma, # T-8660), 1:1000).
-
bioRxiv - Microbiology 2020Quote: ... 0.5 % n-dodecyl b-D-maltoside (Sigma) and EDTA-free protease inhibitor cocktail (Roche) ...
-
bioRxiv - Cell Biology 2021Quote: ... aurora B kinase (Sigma, A5102; 1:100); troponin T ...
-
bioRxiv - Genetics 2022Quote: ... amphotericin B (Sigma-Aldrich, 0.25 μg/mL), gentamicin (Schering-Plough ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 U/ml polymyxin B (Sigma-Aldrich), 8 mg/ml amphotericin B (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 8 mg/ml amphotericin B (Sigma-Aldrich), and 0.2% β-cylodextrin (Thermo Fisher) ...
-
bioRxiv - Microbiology 2022Quote: ... and 250 μg/mL Hygromycin B (Sigma). RS cells (Evercyte ...
-
bioRxiv - Bioengineering 2022Quote: ... + 0.25 µg/mL Amphotericin B (Sigma A2942) until analysis and used within 4 weeks from decellularization ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse monoclonal anti-b-actin (A1978, Sigma), mouse monoclonal anti-GAPDH (5G4 clone ...
-
bioRxiv - Biochemistry 2019Quote: ... anti-tubulin (B-5-1-2, Sigma), anti-FLAG (M2 ...
-
bioRxiv - Microbiology 2019Quote: ... coli media (ChromoSelect Agar B; Sigma Aldrich) per manufacturer protocol ...
-
bioRxiv - Biophysics 2019Quote: ... a solution of Rhodamin B (Sigma-Aldrich) in isopropanol was prepared ...
-
bioRxiv - Microbiology 2021Quote: ... and 250 ng/mL amphotericin B (Sigma) in sterile tissue culture flasks ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-B-actin (Sigma A5441, 1:15,000).
-
bioRxiv - Plant Biology 2020Quote: ... The human [Glu1]-fibrinopeptide B (Sigma-Aldrich) at 100 fmol/μl was used as an external calibrant and lock mass acquisition was performed every 30 s ...
-
bioRxiv - Molecular Biology 2020Quote: ... or porcine skin type B G9391 (Sigma) and 0.5% Low-gelling 2-Hydroxyethyl agarose (A4018 ...
-
bioRxiv - Physiology 2020Quote: ... and 2.5 μg/mL amphotericin B (Sigma)] ...
-
bioRxiv - Neuroscience 2019Quote: ... Map2A/B (1:1000; Millipore cat# MAB378), B-III-tubulin (1:1000 ...
-
bioRxiv - Cell Biology 2019Quote: ... (B) CAGCAGUAGAUGCAUCUUACA[dTdT] and (C) SASI_Hs01_00169803 (Sigma). Cells were reverse transfected with siRNA using RNAiMax (Invitrogen ...
-
bioRxiv - Cell Biology 2019Quote: ... cytochalasin-B (Sigma-Aldrich, St. Louis, MO) was added to the cultures to block cytokinesis of proliferating lymphocytes at a final concentration of 6 μg/mL and cells were cultured for an additional 30 h (total incubation time − 54 h).
-
bioRxiv - Cancer Biology 2020Quote: ... and 500 ng/mL ionomycin b (Sigma) in RPMI 1640 medium (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... polymyxin B (Sigma-Aldrich, Vandtårnsvej, Søborg, Denmark) tobramycin ...
-
bioRxiv - Cancer Biology 2019Quote: ... mobile phase (B) of water (MilliQ, Millipore) and mobile phase (C ...
-
bioRxiv - Physiology 2020Quote: ... 0.9 mM b-NADP (Sigma Aldrich, 10128031001), and 5 mg/ml of G-6P dehydrogenase (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytosporone B (#C2997) was purchased by Sigma and resuspended in DMSO ...
-
bioRxiv - Biochemistry 2021Quote: ... or the CelLytic B reagent (Sigma, USA) according to the manufacturers’ protocol and were stored at -80°C.
-
bioRxiv - Cancer Biology 2020Quote: ... and B-Nicotinamide Adenine Dinucleotide (Sigma-Aldrich). The region of interest (ROI ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.25 μg amphotericin B/mL (Sigma). We used a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2020Quote: ... 10 MU polymyxin B sulphate (Sigma Aldrich), 5 MU nystatin (Sigma Aldrich) ...