Labshake search
Citations for Millipore Sigma :
2251 - 2300 of 4532 citations for Human LACC1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... anti-human talin (mouse monoclonal, 8d4, Sigma Aldrich, T3287; WB 1:750), anti-human FAK (rabbit polyclonal ...
-
bioRxiv - Cancer Biology 2023Quote: ... were as follows: Human pLKO.1-puro-shRNAMAPK14 (Sigma SHCLNG-NM_001315; TRCN0000000511), Human pLKO.1-puro-shRNAMAPK11 (Sigma SHCLNG-NM_002751 ...
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). After blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Cancer Biology 2023Quote: ... human epidermal growth factor (EGF, 20 ng ml−1; Sigma-Aldrich, E9644), human fibroblast growth factor (FGF ...
-
bioRxiv - Cell Biology 2023Quote: ... the epididymal sperm were incubated in human tubular fluid (HTF; EMD Millipore) at 2.0 x 106 cells/ml concentration for 90 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Epidermal Growth Factor (hEGF, Cat# 62253-63-8, Sigma-Aldrich, USA), human Transforming Growth Factor-α (hTGF-α ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4°C with anti-human Fab (Millipore Sigma) diluted 1:500 in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with human epidermal growth factor (hEGF) (20 ng/ml, Sigma E9644) and human fibroblast growth factor 2 (hFGF2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Transforming Growth Factor-β1 (hTGF-β1, Cat# T7039, Sigma-Aldrich, USA), Fibroblast Growth Factor 1 (FGF1 ...
-
bioRxiv - Genetics 2023Quote: ... Human ESCs were lysed with 50-100 µL of RIPA buffer (Sigma) supplemented with 1x Complete EDTA-free Protease Inhibitor cocktail (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Human interferon-β recombinant protein was purchased from Millipore (St. Louis, MO), and for stimulation ...
-
bioRxiv - Immunology 2023Quote: ... the patterned surface was coated with 2.5% human collagen (Sigma #C5533-5MG) diluted in water for 1 h at RT ...
-
bioRxiv - Immunology 2023Quote: ... single stranded DNA (ssDNA, prepared from dsDNA) and human insulin (Sigma, I9278) by ELISA as described (Gitlin et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC0813 medium was supplemented with 10units/mL human recombinant insulin (Sigma-Aldrich), and MHHNB11 medium was supplemented with MEM Non-Essential Amino Acids (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: Human neutrophils were isolated by layering whole blood over Histopaque-1119 (Sigma) followed by a discontinuous Percoll gradient (Amersham Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... we added 1µg 13C and 15N labelled human Apolipoprotein (Apo-1) (Sigma) as a known standard to 50µg total mycelial extract to assess the variance during sample preparation and measurements ...
-
bioRxiv - Immunology 2022Quote: Human 38-plex magnetic cytokine/chemokine kits (EMD Millipore, HCYTMAG-60K-PX38) were used per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Human LDL (hLDL) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Fluorescein isothiocyanate (FITC)-conjugated anti-CD41 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 12µL human insulin (final concentration 2.375-2.875µg/mL, Sigma Aldrich I9278) were added to make SXO HPLM ...
-
bioRxiv - Cell Biology 2023Quote: ... pre-coated with 10 μg/ml Human Plasma Fibronectin (Sigma-Aldrich, FC010). Neurons were mechanically shaken off and removed by patting the flask approximately 2 days after inoculation ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 g/L D-glucose with 1.25% human serum albumin (HSA) (Sigma) and either physiologic (0.1 nM ...
-
bioRxiv - Molecular Biology 2023Quote: The human megakaryoblast leukemic cell line MEG-01 (Sigma-Aldrich, ECACC 94012401) was maintained in RPMI 1640 Medium + GlutaMAX™-I (Gibco™ – Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Fresh citrate-anticoagulated human blood was pre-labeled with Mepacrine (Sigma-Aldrich) for 10 min at RT and perfused over the pre-coated coverslips using a flow chamber system (50 µm x 5 mm ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse antibody specific for human SOD1 (SD-G6 1:100, Millipore Sigma), Mouse anti-human HSP70 specific for stress-inducible HSPA1A (SMC-100B 1:100 ...
-
bioRxiv - Immunology 2023Quote: ... followed by injection of 6.5 U human chorionic gonadotropin (hCG; Sigma-Aldrich) 48 h later ...
-
bioRxiv - Cell Biology 2024Quote: Human retinal pigment epithelial (RPE) cells were cultured in DMEM (Sigma, #D5648) supplemented with 10% fetal bovine serum and maintained at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2024Quote: ... and (2) the Human Cytokine 23-Plex Discovery Assay® (HD23; Millipore MILLIPLEX® Human Cytokine/Chemokine Magnetic Bead Panel II Immunology Multiplex Assay ...
-
bioRxiv - Microbiology 2024Quote: ... and then incubated with either (1) 20 µg human fibronectin (EMD Millipore); (2 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... or 96-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C.
-
bioRxiv - Synthetic Biology 2024Quote: ... or 24-well plates pretreated with 20 µg/mL human fibronectin (Millipore) for at least 10 min at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... human full length NHE1 was cloned into p3xFLAG-CMV-14 (Sigma-Aldrich) containing a C-terminal 3xFLAG tag ...
-
bioRxiv - Cell Biology 2020Quote: ... The lentivirus plasmid vector pLKO 1-YFP was obtained from Sigma’s validated genome-wide TRC shRNA libraries (Sigma-Aldrich ...
-
bioRxiv - Genetics 2021Quote: ... Plasmids were then transformed into Rosetta II cells (Sigma -71402-4) and grown on agar plates with 100mg/ml ampicillin overnight at 37°C.
-
bioRxiv - Microbiology 2020Quote: ... This fragment was cloned into pET24a(+) plasmid NdeI-XhoI digested (Novagen) to generate pET24-Ssr0692 plasmid ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Plasmids encoding the selected populations were extracted using Lyticase (Sigma # L2524). The eUNG gene (636bp ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1μL of 2μg/μL plasmid with 0.1% Fast Green (Sigma) was injected by hand into the lateral ventricle using a Picospritzer II (Parker) ...
-
bioRxiv - Microbiology 2019Quote: ... digested with NdeI and BamHI and inserted into plasmid pET11b (Novagen). For expression of His-tagged proteins (GapDH ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli cultures using Sigma GenElute™ Plasmid Miniprep kit (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2019Quote: ... plasmids were transformed into BL21-Rosetta 2 (DE3)-competent cells (Millipore). The E ...
-
bioRxiv - Biochemistry 2019Quote: ... and ligated into digested pET28a(+) plasmid (#69864-3, Novagen, Merck Biosciences). QIAquick® PCR Purification Kits (QIAGEN ...
-
bioRxiv - Immunology 2021Quote: ... the kanamycin (km) resistance cassette was amplified from plasmid pET26b (Novagen) using primers k1 and k2 ...
-
bioRxiv - Bioengineering 2020Quote: ... and assembled into the pCDF-1b plasmid (ColDF13 ori, Millipore, US) replacing the MCS region by Gibson Assembly ...
-
bioRxiv - Cancer Biology 2020Quote: ... pETDuet-Twist-E47 plasmids were transformed into Rosetta2(DE3)-pLysS (Millipore) bacteria ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmids were transformed into Rosetta2 (DE3) competent cells (Novagen, 71397). The recombinant proteins were purified using SBP-tag and StrepTactin Sepharose ...
-
bioRxiv - Microbiology 2019Quote: ... and cloned into a pSF-CAG-KAN plasmid (Sigma-Aldrich, Merck). These were co-transfected into DF-1 cells with Lipofectamine™ 2000 and the supernatant containing virus was passaged onto additional DF-1 cells to generate viral stocks ...
-
bioRxiv - Biophysics 2021Quote: ... and isolated using the GenElute Plasmid Miniprep kit (Sigma, Cat# PLN350). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... the plasmids were transfected with the FuGENE HD Transfection Reagent (Sigma). After transfection ...