Labshake search
Citations for Millipore Sigma :
2201 - 2250 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Cells were blocked in human blocking buffer (5% human serum (Sigma-Aldrich), 1% rat serum (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2024Quote: ... or 100% C3-depleted human serum (C3-depleted serum, human; Millipore Sigma) for 30 minutes ...
-
bioRxiv - Bioengineering 2021Quote: ... the cells were lysed and the ATP content was measured by an ATP assay kit per manufacturer’s instruction (Millipore Sigma, n = 3).
-
bioRxiv - Genomics 2021Quote: ChIP was performed thrice independently for each antibody using 1×106 SK-N-SH cells for each transcription factor using the EZ-Magna ChIP kit (Millipore Sigma, USA), as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: DNA extraction from mouse tail clips obtained at 7-10 days of age was performed using REDExtract-N-Amp™ Tissue PCR Kit (Cat#R4775, Sigma Aldrich) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Live-cell AIS staining was performed using a mouse anti-neurofascin antibody targeting an extracellular epitope (NeuroMab clone A12/18, #75-172) conjugated with CF647 (Mix-N-Stain CF647 antibody labeling kit, Sigma-Aldrich #MX647S50) following the manufacturer protocol ...
-
bioRxiv - Immunology 2020Quote: ... 1.1 µmol of each HIV synthetic peptide (with C-terminal cysteine added) and 0.22 milliliters 0.3% glutaraldehyde solution (ACS reagent grade, pH 5.5, Sigma-Aldrich) at RT were slowly mixed and left to stand for 1.50 hrs ...
-
bioRxiv - Immunology 2021Quote: ... 1.1 µmol of each HIV synthetic peptide (with C-terminal cysteine added) and 0.22 milliliters 0.3% glutaraldehyde solution (ACS reagent grade, pH 5.5, Sigma-Aldrich) at RT were slowly mixed and left to stand for 1.50 hrs ...
-
bioRxiv - Plant Biology 2021Quote: ... The probes were incubated in reaction buffer (5 mM CoCl2, 400 U/reaction of Terminal Transferase (Sigma Merck) 0.1 mM DIG-11-dUTP (Sigma Merck) ...
-
bioRxiv - Biochemistry 2021Quote: A C-terminal 10x His-tagged Synechocystis PCC 6803 ocp gene (slr1963) was cloned in a pCDFDuet (Novagen), resulting in a plasmid named pEP4 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the Golgi apparatus was detected with rabbit monoclonal anti-GM130 (C-terminal, G7295, SIGMA-Aldrich, Prague, Czech Republic). Detection of bound primary antibodies was achieved using donkey anti-mouse IgG Alexa Fluor 488 donkey anti-rabbit IgG Alexa Fluor 555 secondary antibodies (Thermo Fischer Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... bees were encouraged to extend their proboscis by touching the bee’s terminal antennomers with a droplet (∼3.5 µL) of 0.5 M sucrose (Sigma Aldrich) dissolved in deionised water ...
-
bioRxiv - Cell Biology 2020Quote: ... human Akt1 (Sigma-Aldrich) or 0.3 μg active ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified human ApoA1 (Sigma) or purified ApoA1-ApoM protein was resuspended in PBS (10:1 mol/mol ...
-
bioRxiv - Systems Biology 2020Quote: ... human (GluFib, Sigma Aldrich) was added (0.3 ng/µl ...
-
bioRxiv - Neuroscience 2021Quote: ... recombinant human apoE4 (Sigma), and ThT (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Human HDL (Merck Millipore) was incubated with NS1 for 1 hour at 37°C prior to the DSC experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... human fibronectin (Sigma-Aldrich) 5 µg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... human serum (H2918, Sigma), DMXAA (D5817 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human IgG (Sigma), respectively ...
-
bioRxiv - Molecular Biology 2022Quote: ... human insulin (I9278, Sigma), human TGFβ1 (PHP143B ...
-
bioRxiv - Cell Biology 2022Quote: ... or human fibronectin (Sigma). We found that BSA and collagen IV coating both resulted in reliable cell adhesion ...
-
bioRxiv - Immunology 2022Quote: ... Pooled human serum (Sigma) dilutions and pooled saliva were prepared in a 96-well plate ...
-
bioRxiv - Microbiology 2020Quote: ... 5% human serum (Sigma), Penicillin-Streptomycin ...
-
bioRxiv - Microbiology 2022Quote: Human fibrinogen (Millipore Sigma) was resuspended in PBS at 1 ng/μL ...
-
bioRxiv - Immunology 2022Quote: ... + 10% human serum (Sigma) + 2mM L-glutamine (Sigma ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human fibrinogen (Sigma-Aldrich) labeled with fluorescent Alexa Fluor 647 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 5% human serum (Sigma) and 50% virus solution in RPMI media (Gibco) ...
-
bioRxiv - Immunology 2021Quote: ... Human AB serum (Sigma), recombinant IL-2 ...
-
bioRxiv - Cell Biology 2022Quote: ... with human fibronectin (Sigma) 10 μg/ml for 2h at room temperature under a laminar flow hood ...
-
bioRxiv - Bioengineering 2024Quote: ... human laminin (Sigma-Aldrich) and polyethylene glycol diacrylate (PEGDA ...
-
bioRxiv - Cell Biology 2024Quote: ... Human AB serum (Sigma) was used to prepare unstimulated cells or FCS (Biosera or Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... human serum (H2918, Sigma), Zymosan (Z4250 ...
-
bioRxiv - Biochemistry 2022Quote: ... human serum (Sigma-Aldrich), trypsin (Promega) ...
-
bioRxiv - Bioengineering 2023Quote: ... human recombinant LIF (Millipore), and Heparin (StemCell Technologies) ...
-
bioRxiv - Biochemistry 2024Quote: ... human AC16 cells (Millipore) were cultured in DMEM/F12 supplemented with 10% FBS and either 6% D2O (heavy labeled population ...
-
bioRxiv - Cancer Biology 2024Quote: ... human insulin (Sigma # I0516) was added at a final concentration of 0.01mg/ml ...
-
bioRxiv - Microbiology 2024Quote: ... human transferrin (#T8158, Sigma), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC #P0673) ...
-
bioRxiv - Immunology 2024Quote: Human AB serum (Millipore) was diluted 1/10 to a final volume of 200 mL in ice-cold PBS + 0.1% Tween 20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human E2F1 shRNA (Sigma): TAACTGCACTTTCGGCCCTTT ...
-
bioRxiv - Cell Biology 2024Quote: ... recombinant human (AG968, Sigma). The information for all other reagents is indicated in corresponding sections.
-
bioRxiv - Physiology 2020Quote: ... USA) were pulled to a fine tip and silanized in an atmosphere of N,N-dimethyltrimethylsilylamine (Sigma Aldrich, St. Louis, MO, USA). Silanized glass microelectrodes were then back-filled with 100 mmol L-1 KCl and front-filled with K+ ionophore (K+ ionophore I ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Biochemistry 2023Quote: ... Identification of the VOCs was based on a combination of computer matching with mass spectral libraries (NIST 14) and retention index values derived from an n- alkane solution (c5 to n-c18) (Sigma Aldrich Co.). Only compounds with match factor scores ≥ 70 and signal-to-noise ratios ≥ 10 were selected for quantitation ...
-
bioRxiv - Bioengineering 2024Quote: ... they were simultaneously perfused and soaked for either 48h (n=10) or 72h (n=10) with 1% SDS (Sigma-Aldrich®, USA). All GMs were then agitated with distilled water for 15 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by a 30-min treatment with 70 µL MSTFA [N-methyl-N(trimethylsilyl)-trifluoroacetamide (69479, Sigma-Aldrich, St. Luis, MO, USA) at 37°C and centrifugation ...
-
bioRxiv - Cancer Biology 2023Quote: Tumors excised from AKB6 xenografts that were treated with vehicle (n=2) and MRTX1133 (n=2) were digested using Liberase (Sigma Cat # 05401020001) to get single cells and sent to RPCI’s Genomics Shared Resources for sequencing using 10X Chromium and Illumina’s NovaSeq instruments ...
-
bioRxiv - Microbiology 2023Quote: ... double-stained cells were also stained with 10 μM Laurdan (6-dodecanoyl-N,N-dimethyl-2-naphthylamine, Sigma Aldrich, Zwijndrecht, the Netherland). Laurdan was excited at 395 nm and 470 nm emission wavelength was used for rigid membrane and 508 nm for fluid membrane environment ...
-
bioRxiv - Microbiology 2023Quote: ... containing 1 mg/ml X-gal (Sigma-Aldrich; prepared fresh as a 40 mg/ml stock in N,N-Dimethylformamide (Sigma-Aldrich)) overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... 90 µL of N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide with 1% tert-Butyldimethyl-chlorosilane (TBDMS; Cat. No. 375934, Sigma-Aldrich; St Louis, MO.) was added and samples were incubated under shaking at 37°C for 30 minutes ...