Labshake search
Citations for Millipore Sigma :
2101 - 2150 of 10000+ citations for Recombinant Human SDC2 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... human lactoferrin (hLF) and bovine lactoferrin (bLF) were purchased from Sigma (USA).
-
bioRxiv - Immunology 2020Quote: ... 50 µM β-mercapthoethanol and 20 µg/ml human apotransferrin (Sigma Aldrich, St ...
-
bioRxiv - Immunology 2020Quote: ... Human serum minus (IgA/IgM/IgG) (Cod. S5393, Sigma, St. Louis, USA) was also used as a negative control in MNT and ELISA.
-
Highly Versatile, Non-Invasive Method for Collecting Buccal DNA from Free-Ranging Non-Human PrimatesbioRxiv - Genetics 2021Quote: ... a series of human placental DNA (Sigma-Aldrich, St. Louis, MO, USA) at concentrations of 500 ...
-
bioRxiv - Bioengineering 2022Quote: ... and collagen-IV from human placenta 5 mg/mL (#234154; Sigma-Aldrich) with HEPES (1M ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... HRP-conjugated anti-mouse IgG or anti-human IgG detection antibodies (Sigma) were added at 1:10000 dilution with a final room temperature incubation for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Bioengineering 2022Quote: Synthesized PEGαMA was reacted with thiolated human dECM and DTT (Sigma-Aldrich) crosslinkers off-stoichiometry (3:8 thiol to αMA ...
-
bioRxiv - Cell Biology 2022Quote: ... mice were injected with human chorionic gonadotropin (hCG) (Sigma Aldrich, Cat# CG5) 48 hours after PMSG injection to stimulate ovulation of Metaphase II-arrested eggs ...
-
bioRxiv - Immunology 2022Quote: ... 50 μM β-mercaptoethanol and 20 μg/ml human apotransferrin (Sigma Aldrich; depleted for human IgG with protein G sepharose) ...
-
bioRxiv - Immunology 2022Quote: ELISA plates were coated overnight with anti-human IgG (Sigma Aldrich I5260) at 1:5 000 in PBS ...
-
bioRxiv - Immunology 2022Quote: ... Binding was detected by polyclonal goat anti-human IgE-HRP (Sigma-Aldrich) or mouse anti-human IgG HRP (BD Pharmingen ...
-
bioRxiv - Molecular Biology 2023Quote: Normal Human Dermal Fibroblasts (NHDF) were purchased from Sigma (C-12302, Sigma). Cells were cultured in EMEM (ECB2071L ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:100 penicillin/streptomycin and 10% male human AB serum (Sigma-Aldrich) (“T-cell medium”) ...
-
bioRxiv - Cancer Biology 2024Quote: ... derived from the cortical region of human fetal brain tissue (Millipore, #SCC007) were cultured as previously described74 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1mM sodium pyruvate and 10 µg/ml human insulin (Cat# 19278, Sigma). HUVECs were a kind gift from Prof ...
-
bioRxiv - Cell Biology 2022Quote: shRNAs plasmids were purified from the MISSION® shRNA Human Library (Sigma). Non-targeting control shRNA (shCo ...
-
bioRxiv - Bioengineering 2024Quote: ... the human IgG was purchased from Sigma (Sigma Aldrich, St Louis, MO). Then the IR800 dye was dissolved in DMSO (10mg/ml) ...
-
bioRxiv - Bioengineering 2024Quote: ... or horseradish peroxidase-conjugated goat anti-human IgG Fc antibody (Sigma, A0170) diluted 1:20,000 in the blocking buffer for an hour at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: Human neurons were differentiated from ReNcell VM neuronal precursor cells (EMD Millipore) as described earlier [7] ...
-
bioRxiv - Physiology 2024Quote: ... HBECs were seeded directly onto human placental collagen (HPC, Sigma-Aldrich, C8374)-coated permeable supports (Costar Transwells ...
-
bioRxiv - Cell Biology 2024Quote: Pooled human umbilical vein endothelial cells (Lonza, C2519A or Sigma, 200P-05N) were cultured at 37 °C and 5% CO2 and per manufacture recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... were coated with 1/20,000 dilution of Goat anti-Human Fab (Sigma) overnight at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Fresh citrate-anticoagulated human blood was pre-labeled with Mepacrine (Sigma-Aldrich) for 10 min at RT and perfused over the pre-coated coverslips using a flow chamber system (50 µm x 5 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... human TLR3 (forward: FH2-TLR3; CAACAGAATCATGAGACAGAC; reverse: RH2-TLR3; CACTGTTATGTTTGTGGGTAG; Millipore Sigma), GUSB (forward ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). To enrich for MSCs ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). After blocking ...
-
bioRxiv - Bioengineering 2023Quote: ... Human serum albumin (HSA, A1653) was purchased from Sigma-Aldrich (The Netherlands). Unless noted otherwise ...
-
bioRxiv - Immunology 2022Quote: ... blocking of Fc receptors with human Ig (Sigma-Aldrich, St. Louis, MO); surface staining with mouse anti-human CD3-APC-H7 ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked with 10% normal human AB serum (Sigma-Aldrich). For analysis of neutrophil activation ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human talin (mouse monoclonal, 8d4, Sigma Aldrich, T3287; WB 1:750), anti-human FAK (rabbit polyclonal ...
-
bioRxiv - Cancer Biology 2023Quote: ... were as follows: Human pLKO.1-puro-shRNAMAPK14 (Sigma SHCLNG-NM_001315; TRCN0000000511), Human pLKO.1-puro-shRNAMAPK11 (Sigma SHCLNG-NM_002751 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 12µL human insulin (final concentration 2.375-2.875µg/mL, Sigma Aldrich I9278) were added to make SXO HPLM ...
-
bioRxiv - Immunology 2023Quote: ... the patterned surface was coated with 2.5% human collagen (Sigma #C5533-5MG) diluted in water for 1 h at RT ...
-
bioRxiv - Genetics 2023Quote: ... Human ESCs were lysed with 50-100 µL of RIPA buffer (Sigma) supplemented with 1x Complete EDTA-free Protease Inhibitor cocktail (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Transforming Growth Factor-β1 (hTGF-β1, Cat# T7039, Sigma-Aldrich, USA), Fibroblast Growth Factor 1 (FGF1 ...
-
bioRxiv - Immunology 2023Quote: ... single stranded DNA (ssDNA, prepared from dsDNA) and human insulin (Sigma, I9278) by ELISA as described (Gitlin et al. ...
-
bioRxiv - Immunology 2023Quote: ... were coated overnight at 4°C with anti-human Fab (Millipore Sigma) diluted 1:500 in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with human epidermal growth factor (hEGF) (20 ng/ml, Sigma E9644) and human fibroblast growth factor 2 (hFGF2 ...
-
bioRxiv - Cell Biology 2023Quote: ... the epididymal sperm were incubated in human tubular fluid (HTF; EMD Millipore) at 2.0 x 106 cells/ml concentration for 90 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... human Epidermal Growth Factor (hEGF, Cat# 62253-63-8, Sigma-Aldrich, USA), human Transforming Growth Factor-α (hTGF-α ...
-
bioRxiv - Cancer Biology 2023Quote: ... human epidermal growth factor (EGF, 20 ng ml−1; Sigma-Aldrich, E9644), human fibroblast growth factor (FGF ...
-
bioRxiv - Immunology 2022Quote: Human neutrophils were isolated by layering whole blood over Histopaque-1119 (Sigma) followed by a discontinuous Percoll gradient (Amersham Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... we added 1µg 13C and 15N labelled human Apolipoprotein (Apo-1) (Sigma) as a known standard to 50µg total mycelial extract to assess the variance during sample preparation and measurements ...
-
bioRxiv - Immunology 2022Quote: Human 38-plex magnetic cytokine/chemokine kits (EMD Millipore, HCYTMAG-60K-PX38) were used per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Human LDL (hLDL) was purchased from Sigma-Aldrich (St. Louis, MO, USA). Fluorescein isothiocyanate (FITC)-conjugated anti-CD41 ...
-
bioRxiv - Cancer Biology 2024Quote: ... obtained from the human CRISPR Library (Sigma-Aldrich, St Louis, MO, USA). Transduced cells were selected with puromycin ...
-
bioRxiv - Synthetic Biology 2024Quote: ... mice were injected intraperitoneally with 8 mg of human transferrin (Sigma Aldrich) to promote bacterial growth in vivo ...
-
bioRxiv - Molecular Biology 2023Quote: The human megakaryoblast leukemic cell line MEG-01 (Sigma-Aldrich, ECACC 94012401) was maintained in RPMI 1640 Medium + GlutaMAX™-I (Gibco™ – Thermo Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 g/L D-glucose with 1.25% human serum albumin (HSA) (Sigma) and either physiologic (0.1 nM ...