Labshake search
Citations for Millipore Sigma :
2051 - 2100 of 10000+ citations for Cyclohexyl 2 3 4 5 trifluorophenyl ethyl ketone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... mouse tubulin (clone B-5-1-2, Sigma, T5168-.2ML; 1/5000), and p21 Waf1/Cip1 (clone 12D1 ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 µM each of 5-fluoro-2’-deoxyuridine (Sigma-Aldrich Cat#F0503) and uridine (Sigma-Aldrich Cat#U3003 ...
-
bioRxiv - Neuroscience 2022Quote: ... and 50 μM D,L-2-amino-5-phosphonovaleric acid (AP5, Sigma). Images were acquired at 100 Hz over a 512 × 266 pixel area in frame transfer mode (exposure time 7 ms ...
-
bioRxiv - Microbiology 2023Quote: ... was supplemented with 5 μM 1,4-dihydroxy-2-naphthoate (DHNA) (281255; Sigma) or 5 μM menaquinone (MK ...
-
bioRxiv - Biochemistry 2022Quote: ... plus a 5% (v/v) of 2-Mercaptoethanol (#M7154-25ML, Sigma-Aldrich)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-Tubulin (1:3,000; Sigma clone B-5-1-2, T5168), and mouse anti-b-Actin (1:1,000 ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 μM 5-fluoro-2-deoxyuridine and 20 μM uridine (Sigma-Aldrich).
-
bioRxiv - Neuroscience 2024Quote: ... puromycin and 10 µM 5-fluooro-2’-deoxyuridine (FUdR; Sigma-Aldrich, F0503). 6-well plates were coated with 20 µg/mL poly-L-Ornithin (PLO ...
-
bioRxiv - Neuroscience 2024Quote: ... neuron cultures were treated with 10μM 5-Fluoro-2′-deoxyuridine (Sigma-Aldrich) after 3 days ...
-
bioRxiv - Plant Biology 2024Quote: ... anti-microtubule antibody (1:2,000; clone B-5-1-2; Sigma- Aldrich), and ECL anti-mouse IgG horseradish peroxidase-linked whole antibody (1:1,000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were treated with 5-Aza-2′-deoxycytidine (10 µM; Sigma, A3656) for 96 hours ...
-
bioRxiv - Biophysics 2024Quote: ... and 5% (w/v) 2,2-Dimethoxy-2-phenylacetophenone (Irgacure 651, Sigma Aldrich). The cell-adhesive Resin 2 was made of a mixture of Polyethylene glycol diacrylate (PEGDA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caco-2/TC7 cells were treated with 5 mM EGTA (Sigma-Aldrich) in the apical compartment or human interferon-γ (IFNγ ...
-
bioRxiv - Biochemistry 2022Quote: ... they were cultivated 72 hours in the presence of 2 μM DL-threo-1-phenyl-2-palmitoylamino-3-morpholino-1-propanol (PPMP) (Sigma-Aldrich) to inhibit the synthesis of glucosylceramide-based GSLs 75 and incubated with fluorescent SaroL-1 as previously described ...
-
bioRxiv - Cancer Biology 2021Quote: ... HsNHE9 targeting short hairpin RNA (shRNA) (5’-CCGGCCCTCCATTAAGGAGAGTTTTT CAAGAGAAAACTCTCCTTAATGGAGGTTTTTC-3’) and scramble control (Sigma-Aldrich) (5’-CAACAAGATGAAGAGCACCAA-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... the culture medium was supplemented with 3 μM or 5 μM SU5402 (Sigma-Aldrich, SML0443) before live imaging ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 0.5 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate (8-Br-cAMP; B5386, Sigma Aldrich). After 48 hrs ...
-
bioRxiv - Cell Biology 2021Quote: ... with a 3:1 concentrated solution of 20 nm:5 nm colloidal gold (Sigma Aldrich) blocked with bovine serum albumin ...
-
bioRxiv - Developmental Biology 2022Quote: ... inflorescences from 3-week-old plants were treated with 5 μM 6-BA (Sigma-Aldrich), 50 μM IAA (Sigma-Aldrich) ...
-
bioRxiv - Genomics 2020Quote: ... into 384 well plates containing 3 μl of Smart-seq3 lysis buffer (5% PEG (Sigma), 0.10% Triton X-100 (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Physiology 2023Quote: ... The non-targeting shRNA sequence used as negative control was 5’-CAACAAGATGAAGAGCACCAA-3’ (Sigma-Aldrich). Lentivirus was collected beginning 48-hrs post-transfection and concentrated with Lenti-X Concentrator (Takara Bio USA ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.5% NP-40 (Sigma) in PBS for 5 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following siRNAs were used in this study: siMis12C (Dharmacon siMIS12 5’-GACGUUGACUUUCUUUGAU-3’; Sigma siDSN1 5’-GUCUAUCAGUGUCGAUUUA-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.1% Tween (Fisher)] containing either 5% non-fat milk powder or 3% BSA (Sigma-Aldrich) at room temperature for 40 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... 3-5 kDa fluorescein isothiocyanate– dextran (FITC-dextran; 500 µg/ml, Sigma-Aldrich #FD4-100MG) was added to the culture media in the top channel ...
-
bioRxiv - Biophysics 2024Quote: ... were activated for 5 min with a solution of 3-(Trimethoxysilyl)propyl methacrylate (Sigma-Aldrich, 440159 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 500 µg/ml N6,2’-O-Dibutyryladenosine 3’,5’-cyclic monophosphate sodium salt (dbcAMP, Sigma). Cells were used for experiments up to passage 8 ...
-
bioRxiv - Neuroscience 2020Quote: ... UK) in O2 and maintained with urethane (1.3 g/kg, i.p.; ethyl carbamate, Sigma, Poole, UK), and supplemental doses of ketamine (30 mg/kg ...
-
bioRxiv - Bioengineering 2021Quote: ... n-hexadecane and ethyl acetate were of analytical reagent grade (99%) and purchased from Sigma Aldrich.
-
bioRxiv - Neuroscience 2021Quote: ... The identity of ab2 and ab3 sensilla were first verified with 1% ethyl acetate (Sigma #270989) and 1% pentyl acetate (Sigma #109584 ...
-
bioRxiv - Microbiology 2021Quote: The remaining aliquot from (1) was resuspended in 100 µl Tri-ethyl ammonium bicarbonate TEAB (Sigma) and subjected to dimethyl labeling of Lys and N-termini to increase the mass and reduce the charge ...
-
bioRxiv - Systems Biology 2020Quote: Pacdh-1::GFP;nhr-10(tm4695) animals were treated with 50 mM ethyl methanesulfonate (EMS, Sigma) for four hours and then washed five times with M9 buffer ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were treated with a spike of 25 nM Tetramethylrhodamine ethyl ester perchlorate (TMRE, Sigma 87917) for 30 minutes before imaging ...
-
bioRxiv - Genetics 2023Quote: ... hsp-6p::GFP animals at the L4 stage were incubated with Ethyl-methyl sulfonate (EMS, Sigma). Five plates of 250 F1 progeny each were selected to screen 2500 genomes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... or 400 mg/kg/day of ethyl carbamate (CAS # 51-79-6; Sigma, U2500, Lot # WXBC3505V) in deionized water via oral gavage for 3 consecutive days following the procedure outlined by Labash et al ...
-
bioRxiv - Neuroscience 2023Quote: ... NIDA Drug Supply Program) was dissolved in a 1:1:18 solution of ethyl alcohol (Sigma), emulphor (Alkamuls EL-620 ...
-
bioRxiv - Microbiology 2024Quote: Peptides were phase extracted to remove detergent (deoxycholate) by adding 1.0 ml pure Ethyl Acetate (Sigma), followed by 15 ul 20 % Trifluoroacetic Acid (TFA) ...
-
bioRxiv - Microbiology 2021Quote: ... the MDCK monolayers were washed twice to remove FCS using PBS containing 1 μg/mL of trypsin treated with N-tosyl-L-phenylalanyl chloromethyl ketone (TPCK) (Sigma-Aldrich, St. Louis, Mo, USA), inoculated with each sample ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were counter-stained with DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich) before mounting in Mowiol.
-
bioRxiv - Cell Biology 2020Quote: ... Some sections were additionally labeled with 4′,6-diamidino-2-phenylindole (DAPI, Sigma D9542 ...
-
bioRxiv - Microbiology 2021Quote: ... 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) and chloramphenicol was from Sigma-Aldrich. Haematoxylin and Eosin stain solution was from Thomas Baker.
-
bioRxiv - Bioengineering 2021Quote: ... 242.6 mg of 4-(2-hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Sigma-Aldrich) was dissolved in 1 L of deionized water with a pH value that was adjusted to 8.0 to make 1 mM HEPES buffer solution ...
-
bioRxiv - Bioengineering 2020Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; 1:500, Sigma). The stained sections were mounted in mowiol (Sigma ...
-
bioRxiv - Biophysics 2020Quote: ... were incubated for 4 hours with 2% aqueous Tween solution (Tween20, Sigma-Aldrich), then rinsed with deionized water and blow-dried under a stream of dry nitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... All mice were maintained under continuous sedation by administering 2-4% isoflurane (Sigma) via an anesthesia mask during surgery and prior to euthanasia ...
-
bioRxiv - Bioengineering 2021Quote: ... 2-amino-4-hydroxy-6-methylpyrimidine (33.0 mmol; 4.1 g, Sigma-Aldrich, USA) was dispersed in 1,6-diisocyanatohexane (148.6 mmol ...
-
bioRxiv - Plant Biology 2021Quote: ... rinsed 2 times and blocked with 4% (w/v) bovine serum albumin (Sigma) for 1h ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were stained with DAPI (4’,6-diamidino-2-phenylindole) solution (Sigma-Aldrich) and mounted with Fluoroshield (Sigma-Aldrich) ...