Labshake search
Citations for Millipore Sigma :
2001 - 2050 of 2320 citations for 8 IODOMETHYL QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Tg37+/- whole hippocampus non-cell specific nascent translatome labelling was accomplished with 4mM AHA (Fluorochem, # 942518-29-8) mixed with 5% Maltose (Sigma, M9171) in drinking water and in a mash diet from 9 w.p.i to 10 w.p.i ...
-
bioRxiv - Molecular Biology 2023Quote: ... 150 μL cell suspension was mixed with 150 μL DB+ containing 8 mM caffeine (Wako) and 20 μM latrunculin A (Sigma-Aldrich) and placed on a 35-mm glass bottom dish (12-mm glass in diameter ...
-
bioRxiv - Molecular Biology 2023Quote: ... MCF10A cells were infected for 24 h using filtered viral supernatant diluted with culture medium and supplemented with 8 µg/µl protamine sulphate (Sigma-Aldrich). Selection of infected cells with antibiotics was performed 48 h after the infection.
-
bioRxiv - Microbiology 2023Quote: NIH3T3 and BMDC cells were infected with MLV (genome equivalent of a multiplicity of infection [MOI] of 1) in the presence of 8 mg/ml Polybrene (Sigma-Aldrich), and cells were incubated on ice for 1 h to allow virus binding ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transduced with HIV-TOP opt mChΔW lentivirus containing the PIKA library by spinoculation in the presence of 8 µg/mL protamine sulfate (Millipore Sigma #P3369). Two days later (Experiment Day 4) ...
-
bioRxiv - Biophysics 2023Quote: ... Dextran from Leuconostoc spp (Mw 450-650 kg/mol), and poly(ethylene glycol) (PEG 8000, Mw 8 kg/mol) were purchased from Sigma-Aldrich. Chloroform obtained from Merck (Darmstadt ...
-
bioRxiv - Microbiology 2023Quote: ... Infection was maintained in 10% FBS DMEM supplemented with 8 µg ml-1 polybrene infection reagent (#TR- 1003-G, Sigma-Aldrich). Twenty-four hours post-infection cells were washed with PBS and the medium was refreshed with complete culture medium ...
-
bioRxiv - Microbiology 2023Quote: ... 5 or 10 μM nocodazole supplemented 10% FBS DMEM medium with 8 µg mL-1 polybrene infection reagent (#TR-1003-G, Sigma-Aldrich). Seven hours after transduction ...
-
bioRxiv - Immunology 2023Quote: ... digested with 0.1% trypsin (Wisent Inc., Canada) for 8 min and then transferred into 0.8 mg/mL Collagenase Type I (Sigma-Aldrich, USA) for 60 min at 37 °C and 5% CO2 with regular vigorous shaking in a humidified incubator ...
-
bioRxiv - Microbiology 2023Quote: ... for 1 h on ice in culture medium in the presence of 100 µg ml-1 cycloheximide and 8 µg ml-1 polybrene infection reagent (#TR-1003-G, Sigma- Aldrich) and then placed at at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2023Quote: ... 100,000 T84 cells per well were seeded on glass bottom 8-well chamber slides coated with 2.5% human collagen (Sigma #C5533-5MG) diluted in water ...
-
bioRxiv - Pathology 2023Quote: ... The cells were infected with lentiviruses carrying the plasmid (MOI = 6) in the presence of Hexamethidine Bromide (8 µg/mL; Sigma-H9268) for 24 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... osm-9 gDNA was amplified with the primers KLB289 (GTTGTTTACCTTTTATGTTCATCCG) and KLB290 (AAATTTTCTACTGCCTGGTATCAAA) off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich). The osm-9 gDNA fragment plus extra upstream and downstream homologous sequence was amplified off of the gDNA amplified with KLB289 and KLB290 ...
-
bioRxiv - Cell Biology 2023Quote: ... Genetical labelling was induced in epidermis of 6-8 weeks old mice with a single topical administration of 75 μg of (Z)-4-Hydroxytamoxifen (Sigma-Aldrich) (15 mg/mL diluted in acetone).
-
bioRxiv - Bioengineering 2023Quote: ... K562 or Jurkat T cells were seeded into a 24-well plate at 2.5 × 105 cells/well in 1 ml cRPMI and transduced in the presence of protamine sulfate (8 μg/ml, Sigma-Aldrich). Transgene expression was assessed 72 hours post-transduction by flow cytometry ...
-
bioRxiv - Cell Biology 2022Quote: ... the dissociated cells were resuspended in the transduction medium (1 uL to 5 uL of lentivirus, 4 to 8 ug/ml Polybrane[STR-1003-G, Sigma Aldrich] ...
-
bioRxiv - Cell Biology 2023Quote: S2naive and S2Xpress cells were seeded in an 8-chamber Nunc LabTek II that had previously been coated with Poly-L-Lysine (P4832, Sigma-Aldrich). Cells were then incubated for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mL of S2 cell pellets were lysed with 400 μL lysis buffer containing non-ionic detergent (50 mM Tris buffer, pH 8, 150 mM NaCl, 1% IGEPAL CA- 630 (Cat# I8896, Sigma Aldrich), 10% glycerol and 1x protease inhibitor (Cat# A32965 ...
-
bioRxiv - Bioengineering 2023Quote: ... Droplets of the polymer solution were placed between activated dishes and a Sigmacote®-treated 8 mm coverslip (Sigma-Aldrich, US), and allowed to polymerize ...
-
DeCOIL: Optimization of Degenerate Codon Libraries for Machine Learning-Assisted Protein EngineeringbioRxiv - Bioengineering 2023Quote: ... They are next lysed in 300 μL lysis buffer (50 mM potassium phosphate at pH 8, 0).1 mM pyridoxal phosphate (Sigma P9255), 0.1x BugBuster (EMD Millipore Corp ...
-
bioRxiv - Cell Biology 2023Quote: ... either fresh or thawed DCs (differentiation day 8) were stimulated for 24 h with 200 ng/ml lipopolysaccharide (LPS; E. coli O26:B6, Sigma-Aldrich) and used for experiments on day 9 ...
-
bioRxiv - Genetics 2023Quote: ... RBC lysis buffer (8% Ammonium chloride [NH4Cl], 0.8% Sodium bicarbonate [NaHCO3, Sigma-Aldrich, USA] and 0.4% Ethylenediaminetetraacetic acid [EDTA, Sigma-Aldrich, USA]).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 10 mg of hymenophore tissue from each specimen was homogenized in 2.0 ml screw-cap tubes containing a single 3.0 mm and 8 x 1.5 mm stainless steel beads using a BeadBug™ microtube homogenizer (Sigma-Aldrich, #Z763713) for 120 seconds at a speed setting of 3500 rpm ...
-
bioRxiv - Cancer Biology 2024Quote: ... Immunoprecipitation was performed using 8 µg of fragmented DNA incubated for 14h at 16°C with 20 µg of S9.6 antibody (Millipore, cat. MABE1095). Next the complexes were captured on ProteinA/G agarose beads (ThermoFisher Scientific R0561) ...
-
bioRxiv - Developmental Biology 2024Quote: ... the lysates were separated on 8% v/v or 12% v/v polyacrylamide gels and transferred to a Polyvinylidene difluoride (PVDF) membrane (Millipore ISEQ00010). Membranes were incubated in 5% w/v milk buffer for 1 h at room temperature and incubated in primary antibody overnight at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... quail were placed in glass chambers (3.3 L at 3 weeks; 8.0 L at 8 weeks) ventilated with dried (via drierite; Sigma-Aldrich, Stockholm, Sweden) atmospheric air at least 30 minutes before measurement ...
-
bioRxiv - Molecular Biology 2023Quote: ... HelaS3 cells were transduced for 48 h in 6 well plate in 1 ml of medium containing 8 µg/mL of polybrene (Sigma-Aldrich). VHL-NbGFP4-FLAG HelaS3 cell line was obtained after selection with 1 µg/mL of puromycin (Invivogen).
-
bioRxiv - Biochemistry 2023Quote: Clicked and dissolved protein samples were diluted to 4 M urea with 50 mM ammonium bicarbonate (pH 8, AmBic, Sigma-Aldrich). The proteins were reduced with 4 mM DTT (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: Dissected tumors were washed in PBS and homogenized at room temperature in urea lysis buffer (8 M urea, 40 mM Tris pH 7.6, 5% SDS supplemented with phosphatase inhibitor cocktails 2, 3 (Sigma P5726, P0044)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Both HCC1954WT and HCC1954KO cells were transduced with the pLenti CMV Puro LUC reporter vector at MOI = 5 in the presence of 8 μg/mL of Polybrene (Sigma-Aldrich). Infected cells were selected by puromycin (2.5 μg/mL for 72h ...
-
bioRxiv - Biochemistry 2023Quote: ... Infection of PC3-AR-DTX3LKO cells were carried out in the growth medium (RPMI 1640 + 5% FBS + 1% Penicillin-Streptomycin solution) in the presence of 8 µg/ml of hexadimethrine bromide (Sigma H9268). After 2-3 cell doublings ...
-
bioRxiv - Cell Biology 2023Quote: ... 3.5 x 107 K562 cells expressing Cas9-BFP were resuspended into 60 ml of viral media with 8 μg/ml polybrene (hexadimethrine bromide, Sigma-Aldrich) in 6-well plates ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were washed with A-RPMI and cultured from day 4 to day 8 in A-RPMI supplemented with 1 μM retinoic acid (Sigma R2625) and 100 ng/ml FGF2 ...
-
bioRxiv - Microbiology 2024Quote: ... BEAS-2B cells grown in 6-wells plates were first transduced with lentiviruses encoding Cas9 diluted in infection medium (DMEM, 2% FCS) containing 8 μg/ml Polybrene (Sigma Aldrich). At 16 h post transduction ...
-
bioRxiv - Microbiology 2023Quote: ... The normal group was intraperitoneally administered a dose of 8 mL/kg of 0.5% carboxy methyl cellulose (Sigma-Aldrich, MO, USA) as an excipient ...
-
bioRxiv - Physiology 2024Quote: ... cells were not serum-deprived and incubated 24h after seeding with no secretagogue (Basal) or with 10-8 M AngII (Sigma-Aldrich), 12 mM K+ (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... the pellet was suspended in ice-cold lysis buffer [20 mM Tris-HCL pH 8 with 10 U mutanolysin (Sigma Aldrich), cOmplete™ ...
-
bioRxiv - Cell Biology 2024Quote: ... equal amounts of proteins were loaded onto polyacrylamide gels (8-12%) under reducing conditions and transferred to Immobilon-P membranes (EMD Millipore). After blocking with 5% BSA (wt/vol ...
-
bioRxiv - Immunology 2024Quote: ... and for reconstitution experiments were transduced for 48 h with the respective lentiviral particles (see below) in the presence of polybrene (8 μg/ml, Sigma-Aldrich) prior to selection with puromycin (1 μg/ml ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat anti- cytokeratin 8 (TROMA-I; Developmental Studies Hybridoma Bank; 1:500) and rabbit anti- Sox9 (Millipore, Burlington, MA; 1:750). Detection of antibody binding was with the appropriate species-specific Biotin-SP-conjugated goat anti-antibodies (1:400 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... CAS no 320-67-2), retinoic acid (RA, CAS no-302-79-4) and AM580 (CAS no- 102121-60-8) were purchased from Sigma Aldrich. The stock solution of all chemicals were prepared in high performance liquid chromatography (HPLC ...
-
bioRxiv - Molecular Biology 2024Quote: ... a total of 5 μg of plasmid and dsRNA were transfected into BmN4 cells (8 × 105 cells per 10 cm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche) every 3 days four times ...
-
bioRxiv - Developmental Biology 2024Quote: ... Embryos were rinsed with PBS and stained according to manufacturer’s protocol (Millipore #BG-6-B, #BG-7-B, #BG-8-C). Embryos were then fixed again in 4% PFA (in PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus-containing media was harvested at 72-hour post-transfection and used to infect the H82 cells with 8 µg/mL Polybrene (Sigma #TR1003G). GFP+ cells were selected by fluorescence-activated cell sorting after 72-96 hours on a BD FACSAria II using FACSDiva software.
-
bioRxiv - Cancer Biology 2024Quote: ... were washed two times with PBS and lysed by scraping into 500 μl per plate of lysis buffer (40 mM Tris/HCl pH 7.6, 8 M urea, EDTA-free protease inhibitor complete mini [Roche], and phosphatase inhibitor cocktails 1, 2, and 3 [Sigma-Aldrich] at 1× final concentration according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Wild-type 3T3 cells at 60-80% confluency were incubated for 24 h with 100X virus suspension and 8 µg/ml of Polybrene Transfection Reagent (Millipore Sigma). To maintain stable knockdown ...
-
bioRxiv - Cancer Biology 2024Quote: Whole gastrocnemius skeletal muscle samples were obtained from the limb contralateral to the tumor-implanted flank and cryo-embedded in transverse myofiber orientation protruding from a 1:8 volume mixture of Gum Tragacanth powder (Sigma-Aldrich) to Tissue Freezing Medium (TFM ...
-
bioRxiv - Biochemistry 2024Quote: ... Adherent Expi293 cells were infected with concentrated lentiviral particles at 75% confluency in adherent culture media supplemented with 8 μg/mL polybrene (Sigma-Aldrich), then incubated for 48 h at 37 °C ...
-
bioRxiv - Genomics 2024Quote: ... Jurkat cells expressing Zim3-dCas9-P2A-mCherry were transduced with dJR092 library lentivirus by spinfection (1000g) with polybrene (8 µg/mL, Sigma-Alrich) with a targeted low infection rate of ∼10% ...
-
bioRxiv - Bioengineering 2024Quote: ... devices were plasma treated again for two and a half minutes and 10 µL of 8% Pluronic F68 (P1300, Sigma-Aldrich) was added to the device to prevent cell sticking ...