Labshake search
Citations for Millipore Sigma :
2001 - 2050 of 10000+ citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 3 μg of anti-H3K4me3 (Sigma 04-745) with protein A ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3 µM GSK inhibitor (CHIR99021, Sigma-Aldrich). The medium was exchanged every three days until the RPE spheroids were fully pigmented (12-15 days) ...
-
bioRxiv - Cell Biology 2023Quote: ... After blocking with 3% BSA (Sigma Aldrich, A4503), membranes were incubated with primary antibodies against EIF2α (Cell Signalling Technology ...
-
bioRxiv - Cell Biology 2023Quote: ... Then 3 mL Accutase (Sigma Aldrich, catalog #: A6964) was added to the cells and incubated for 2 min at 37 °C until the cells were floating with minimal clumps under a microscope ...
-
bioRxiv - Genomics 2023Quote: ... indole-3-acetic acid (IAA) (Sigma-Aldrich #12886) was injected into the growth chamber and media reservoir to achieve a final concentration of 500 µM ...
-
bioRxiv - Developmental Biology 2024Quote: ... 3 µM Chiron or CHIR99021 (Sigma-Aldrich SML1046), and 1 µM PD0325901 (Sigma-Aldrich PZ0162) ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3% w/v Quadrol (Sigma-Aldrich 122262).
-
bioRxiv - Microbiology 2024Quote: ... and 0.5mM carbonyl cyanide 3-chlorophenylhydrazone (CCCP; Sigma) were prepared in DMSO and stored at –20°C until use ...
-
bioRxiv - Plant Biology 2024Quote: ... and 3% w/v Quadrol (Sigma-Aldrich 122262).
-
bioRxiv - Bioengineering 2024Quote: ... working buffer (3 mg/mL BSA (Sigma-Aldrich) in DPBS with 0.01% Tween-20 ...
-
bioRxiv - Cell Biology 2024Quote: ... + 3% bovine serum albumin (BSA) (#A7906, Sigma-Aldrich). The membranes were immunoblotted with primary antibodies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and 3 ml propionic acid (Sigma-Aldrich #P5561), per litre of medium ...
-
bioRxiv - Neuroscience 2024Quote: ... 3% bovine serum albumin (Sigma Cat# A9647-500G), 2% normal donkey serum (Jackson ImmunoResearch Cat# 017-000-121)) ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with phosphatase inhibitor cocktail 3 (Millipore-Sigma) was added to each of the tissue samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 3 mM GSK3 inhibitor CHIR99021 (SML1046, Sigma). nPSCs were fed every day and split every 2-3 days using Accutase (A6964 ...
-
bioRxiv - Immunology 2024Quote: ... and 3 mM of valproic acid (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2024Quote: ... and 1x Phosphatase Inhibitor Cocktail 3 (Sigma, P0044). Protein concentration was measured using Pierce BCA Protein Assay Kit (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... and AKT2i (3 µM) (Sigma-Aldrich, no. 124029) was added 1 h prior to LPS stimulation ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by treatments with 3% hydrogen peroxide (Sigma) and 10% methanol (Sigma ...
-
bioRxiv - Microbiology 2024Quote: Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) (Sigma Aldrich, C2759) was used at a concentration of 10 µM for 4 h or 12 h (as indicated in the experiment) ...
-
bioRxiv - Immunology 2024Quote: ... 3 volumes of Trizol (TRI Reagent, Sigma T9424) were added to the fractions and RNA was isolated using the DIrect-zol RNA Miniprep Plus Kit (Zymo cat# R2052) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and GSK-3 Inhibitor XVI (Sigma-Aldrich 361559).
-
bioRxiv - Molecular Biology 2024Quote: ... at 3 μM and PD184352 (Sigma #PZ0181-25MG) at 0.8 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 µg of free biotin (Sigma-Aldrich, #B4639) was added to the lysate during the incubation ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with phosphatase inhibitor cocktail 3 (Millipore-Sigma) was added to each of the tissue samples ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3% bovine serum albumin (BSA, Sigma #A2153) while placed on an OrganoFlow rocker ...
-
bioRxiv - Biochemistry 2024Quote: ... 60 nM siZWINT (Sigma-Aldrich, 5’-GCACGUAGAGGCCAUCAAA-3’) for 48 h ...
-
bioRxiv - Biophysics 2024Quote: ... then functionalized sequentially with 3-glycidyloxypropyl trimethooxysilane (Sigma), diamino-polyethylene glycol with molecular weight 400 Da (#PSB-3640 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were treated with 3% paraformaldehyde (Sigma-Aldrich) and fixation quenched after 30 min by adding 125 mM glycine ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 3% BSA-PBS (Sigma; A4503-100G), stained with rabbit anti-Yersinia pestis sera (1:1,000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 mM EDTA (pH 8) (Sigma-Aldrich) for 30 min at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... endogenous peroxidase inactivation with 3% H2O2 (H1009, Sigma) and were also blocked in 5% BSA in TBST ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 uM Oleic Acid (Cat# 03008; Sigma-Aldrich) was applied overnight to iMGLs ...
-
bioRxiv - Neuroscience 2024Quote: ... odors (4-methylcyclohexanol or 3-octanol; Sigma-Aldrich) were delivered through an air-flow that was held stable at 0.750L per minute ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 μM cytosine-arabinoside (AraC; C1768, Sigma-Aldrich) was added to eliminate microglia ...
-
bioRxiv - Physiology 2024Quote: ... and 3 μg/ml Laminin (L2020; Sigma-Aldrich). The conditioned medium from both day 5 and 7 were thawed ...
-
bioRxiv - Neuroscience 2024Quote: ... 1X Phosphatase Inhibitor Cocktail 3 (Sigma-Aldrich, #P0044)] and incubated in ice for 30 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1250 U of Benzonase (Millipore, 71205-3). Lysis was accomplished via 4 passages through an American Laboratories French Pressure cell ...
-
bioRxiv - Synthetic Biology 2024Quote: 3% (w/v) porcine mucin (M2378, Sigma-Aldrich) was dissolved in nuclease-free water and stirred overnight at RT to obtain mucin gel mimicking mucus layer ...
-
bioRxiv - Bioengineering 2024Quote: ... 3 µM CHIRR99021 (Sigma-Aldrich, 252917-06-9), 50 ng/mL Activin A (Stem cell technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... and MgCl2 (Sigma, UK, final concentration: 3 mM) were added ...
-
bioRxiv - Bioengineering 2024Quote: ... 3-(trimethoxysilyl)propyl methacrylate (TMSPMA, 440159, Sigma-Aldrich), photomask films (custom-made ...
-
bioRxiv - Cancer Biology 2024Quote: ... DL-indole-3-lactic acid (Sigma Cat#I5508), tryptophan and indole-3-acetic acid ...
-
bioRxiv - Biophysics 2024Quote: ... phosphate inhibitor cocktail 3 (P0044, Sigma-Aldrich, Germany), sodium fluoride (S7920 ...
-
bioRxiv - Cell Biology 2024Quote: ... we added 10% APTES (3-Aminopropyl triethoxysilane; Sigma) in absolute ethanol for 1 h at 65 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Bioengineering 2024Quote: ... p-hydroxyphenyl acid (pOHPAA; 1.0e-3 M, Sigma), in 0.25 M Tris buffer (Sigma) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 250 ng/mL R-spondin 3 (Sigma, #SRP3323), 5 nM heregulin (StemCell ...
-
bioRxiv - Cell Biology 2024Quote: ... Followed by blocking with 3% BSA (A2153, Sigma) in PBS-T at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.05% bromophenol blue (Sigma-Aldrich, 03-4140-3), 0.25 M DTT (Nacalai ...