Labshake search
Citations for Millipore Sigma :
1951 - 2000 of 10000+ citations for ST2 Human ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: TLC plates (Silica gel 60, Sigma-Aldrich) were cut to the required size ...
-
bioRxiv - Neuroscience 2022Quote: ... Plates were coated with 0.1% PEI (Sigma) in 2× Borate buffer (Thermofisher ...
-
bioRxiv - Immunology 2020Quote: ... in a 96-well filter plate (Millipore Multiscreen ...
-
bioRxiv - Genetics 2021Quote: ... on plates coated with 0.1% gelatin (Millipore) or on a feeder layer of CF-1 IRR mouse embryonic fibroblast (TebuBio).
-
bioRxiv - Microbiology 2021Quote: ... Milliplex magnetic bead cytokine/chemokine plates (Millipore) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... plates were centrifuged (Sigma Model 4-16S) at 6000 rpm for 2 minutes ...
-
bioRxiv - Immunology 2022Quote: ... 96-well MultiScreen-HA filter plates (Sigma) were coated with µg/well with V ...
-
bioRxiv - Bioengineering 2022Quote: PBS pre-wetted 96 well plates (Millipore) were coated overnight at 4 °C with goat anti-human IgG (H + L ...
-
bioRxiv - Biochemistry 2019Quote: ... lidded Greiner 96-well plate (Sigma-Aldrich). Fluorescent spectra were recorded with a SpectraMax i3 (Molecular Devices ...
-
bioRxiv - Immunology 2019Quote: ... in a 96-well filter plate (Millipore Multiscreen ...
-
bioRxiv - Biophysics 2020Quote: Cellasic microfluidic flow cell plates (Millipore, Y04C) controlled by an ONIX or ONIX2 (Millipore ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and grown on LB agar plates (Sigma) containing appropriate antibiotics ...
-
bioRxiv - Immunology 2020Quote: ... 96-well EIA/RIA plates (Sigma Aldrich) were coated overnight with 0.5ug/ml NP23-BSA in PBS at room temperature and thereafter washed once in wash buffer (PBS+ 0.1% Tween20 ...
-
bioRxiv - Microbiology 2021Quote: Millipore ELISPOT plates (Millipore Ltd, Darmstadt, Germany) were coated with anti-IFN-γ capture Ab (CTL ...
-
bioRxiv - Neuroscience 2019Quote: ... black wall plates (Sigma cat# CLS3340-50EA), transduced on 1-3 day in vitro (DIV) ...
-
bioRxiv - Microbiology 2020Quote: MultiScreen-HA filter 96-well plates (Millipore) plates were pre-coated with 3 µg/ml of SARS-CoV-2 S protein overnight at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... conical 96 well non-skirted plates (Sigma) containing 2μl of lysis buffer (1.9ml of 0.2% v/v Triton-X l00 v/v + 0.1ml of RNasin Plus RNase inhibitor (10,000 U/ml ...
-
bioRxiv - Immunology 2020Quote: ... ELISpot plates (Multi Screen-HA, Millipore, UK) were coated with 100 μl per well of appropriate antigen or antibody diluted in carbonate/bicarbonate buffer for 2h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... 96-well ELISpot plates (Millipore, Cat# MSIP45) were coated overnight with either Dengue 2 fixed virus antigen (Microbix ...
-
bioRxiv - Immunology 2020Quote: ... Plates were developed with TMB substrate (Sigma), stopped with 0.15M sulphuric acid and read at 450nm ...
-
bioRxiv - Immunology 2021Quote: ... ELISPOT plates (S5EJ044I10; Merck Millipore, Darmstadt, Germany) pre-wetted with 30 µl of 70% ethanol for a maximum of 2 minutes ...
-
bioRxiv - Immunology 2020Quote: ... ELISpot plates (Multi Screen-HA, Millipore, UK) were coated with 100 µl per well of appropriate antigen or antibody diluted in carbonate/bicarbonate buffer for 2h at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... The plate was then sealed (Sigma, Z369667) and incubated at 60°C for 20 mins ...
-
bioRxiv - Microbiology 2022Quote: ... using plates coated with GM1 (Sigma G7641), as previously described91.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Plates were sealed with Aeraseal (Millipore-Sigma) and put in a 37C incubator maintained at 5% CO2 for 30 minutes to equilibrate ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Plates were sealed with Aeraseal (Millipore-Sigma) and put in a 37C incubator maintained at 5% CO2 for 30 minutes to equilibrate ...
-
bioRxiv - Biochemistry 2022Quote: ... lidded Greiner 96-well plates (Sigma-Aldrich). To assess the impact of peptides ...
-
bioRxiv - Immunology 2024Quote: ... plates were incubated with avidin-HRP (Sigma) (1:500 in blocking buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... NUNCImmuno 96-well plates (SIGMA-M9410-1CS) were coated with 100 µL of 4 µg/mL polyclonal anti-lysostaphin antibody (AICBIOTECH-PAb102 ...
-
bioRxiv - Biochemistry 2023Quote: ... For plates receiving asparagine (Sigma-Aldrich, A7094), this was added to 1 mM from a 20x solution in water ...
-
bioRxiv - Immunology 2024Quote: ... The 96-well ELISPot filter plates (Millipore) were pre-coated with 15 μg/ml capturing monoclonal anti-human IgG mAbs (Mabtech ...
-
bioRxiv - Microbiology 2023Quote: ... and plates developed using TMB substrate (Sigma), stopped using sulphuric acid and read at 450nm ...
-
bioRxiv - Microbiology 2022Quote: ... and LB agar plates (1.5% agar, Sigma) supplemented with antibiotics as indicated ...
-
bioRxiv - Immunology 2022Quote: ... 96-well MultiScreenHTS IP Filter Plate (Millipore) was activated with 35% ethanol and coated with 15 µg/ml MT327 coating antibody overnight at 4C ...
-
bioRxiv - Microbiology 2023Quote: ... Millipore ELISPOT plates (Millipore Ltd, Darmstadt, Germany) were coated with 100 µl rSARS-CoV-2 spike protein (R&D Systems) ...
-
bioRxiv - Immunology 2023Quote: ... Transwell plates were from Sigma-Aldrich (#CLS3470).
-
bioRxiv - Immunology 2023Quote: ... MultiScreen-IP Filter plates (MAIPSWU10; Merck Millipore) were pre-wetted with 50 µL of 70% ethanol for ≤ 2 mins ...
-
bioRxiv - Cancer Biology 2023Quote: White-bottom ELISpot HTS plates (MSIPS4W10, Millipore) were hydrophilized with 35 % EtOH and subsequently coated with anti-human IFNγ (1-D1K ...
-
bioRxiv - Neuroscience 2023Quote: ... plates sealed with BreathEasy membrane (Sigma Aldrich), and placed in 5% CO2 incubator at 37°C for duration of experiment ...
-
bioRxiv - Immunology 2024Quote: ... MultiScreen 96-well filtration plates (Merck Millipore) were coated with LPS or porins (5 µg/ml ...
-
bioRxiv - Immunology 2024Quote: ... 96-well multiscreen plates (Millipore, MA, USA) were coated with 1µg/well of mouse anti-human IFN-γ (MabTech. ...
-
bioRxiv - Microbiology 2024Quote: ... Millipore ELISPOT plates (Millipore Ltd, Darmstadt, Germany) were coated with CHIKV peptide pools (15 µg/ml) ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were then washed twice 5 min in TBST and incubated with the primary antibody over night at 4°C (human and mouse a-syn: 610786 BD Biosciences; human α-syn: 804-258-1001, Enzo Life Science; beta-actin: A4700, Sigma). After incubation with the first antibody ...
-
bioRxiv - Microbiology 2019Quote: ... RPE-1 cells (ATCC® CRL-4000™) and Human foreskin fibroblasts (Hff1; ATCC® SCRC-1041™) were maintained in DMEM (Sigma) supplemented with 10% heat-inactivated FBS and 100 U/mL penicillin and 100 µg/mL streptomycin ...
-
bioRxiv - Physiology 2021Quote: ... injection of sterile glucose solution (10% glucose in 0.9% saline at 1 g/kg body weight for the GTT) or human insulin (0.75 unit/kg body weight, I9278, Sigma Aldrich for the ITT), following which pin-prick blood samples were collected up to 120 min post-injection ...
-
bioRxiv - Cell Biology 2021Quote: Binding of RBD to the surface of cells was measured by flow cytometry after incubation with increasing doses of human lactoferrin (0, 1, 5 and 10 mM) (Sigma Aldrich Cat#: L1294) in a final volume of 100 μL of culture medium ...
-
bioRxiv - Molecular Biology 2020Quote: Lentiviral pLKO.1-puro empty vector control plasmid and human TENT4A shRNA pLKO.1-puro plasmid (clone TRCN0000053036, target sequence CCAACAATCAGACCAGGTTTA) were obtained from Sigma (Mission shRNA library). Lentiviruses were produced in 293FT cells ...
-
Microhomology-Mediated Circular DNA Formation from Oligonucleosomal Fragments During SpermatogenesisbioRxiv - Genomics 2023Quote: ... The cauda epididymis was quickly cut into pieces and incubated in 1 ml pre-warmed human tubal fluid (HTF) (Millipore, MR-070-D) for 15 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... diluted in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich in PBS) for 30 minutes at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and immediately incubated at 4°C in the primary antibody against the N-terminus of human Fos (overnight, 1:2000; Rabbit polyclonal, ABE457, Millipore; RRID: AB_2631318 (56) (Exp ...