Labshake search
Citations for Millipore Sigma :
1951 - 2000 of 10000+ citations for Ribonuclease P Protein Subunit p38 RPP38 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... stained overnight with 500 μg/mL p-iodonitrotetrazolium violet (Sigma, St. Louis, MO), and counted using an Oxford Optronix GelCount colony counter.
-
bioRxiv - Cancer Biology 2024Quote: ... Pieced were then collected and digested in 1 mg/ml Collagenase P (Sigma) at 37°C for 20 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were visualized with 1:20,000 anti-rabbit IgG (whole molecule)-peroxidase secondary antibody (Sigma; A0545, lot 022M4811) and SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... protein extracts from SCN cultures were examined by SDS-PAGE immunoblotted with anti-UBE3A monoclonal antibody (E8655, Sigma), or anti-FLAG monoclonal antibody (F1804 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein levels of wild-type or mutant Rad6 were determined by immunoblotting using anti-Flag M2 antibody (Sigma).
-
bioRxiv - Biochemistry 2020Quote: ... Lamin proteins were detected using mouse anti-myc antibodies (clone 4A6, Millipore cat #05-724; 1:10000 dilution) decorated with goat anti-mouse secondary IRDye 680RD antibodies (LI-COR) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-parvalbumin (PV;P3088) and anti-glial fibrillary acidic protein (GFAP;G3893) antibodies were obtained from Sigma-Aldrich; bromodeoxyuridine (BrdU ...
-
bioRxiv - Microbiology 2021Quote: ... MERS S-protein was detected using a monoclonal anti-FLAG M2-HRP conjugated antibody (SIGMA, A8592 @ 1:2000) which bound to a C-terminal FLAG-tag ...
-
bioRxiv - Immunology 2020Quote: For immunoprecipitation experiments the Chk1 or GATA3 antibody was incubated with Red Protein G Affinity beads (Sigma-Aldrich) for 1 hour at 4°C on a shaker to allow the antibody to bind to the beads ...
-
bioRxiv - Physiology 2020Quote: ... and purified cell surface proteins were analyzed by western blot using the mαNaVPAN antibody (1:2000, Sigma, #S8809), the anti-transferrin receptor mouse monoclonal antibody (TransR ...
-
bioRxiv - Microbiology 2021Quote: ... the separated proteins were transferred to nitrocellulose and probed with commercial primary antibodies recognizing FLAG (Sigma, cat# F3165), HA (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... Input lysates and pulldown proteins were analyzed by western blotting with the anti-FLAG M2 monoclonal antibody (Sigma) and anti-GAPDH monoclonal antibody (Cell Signaling ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were transferred to PVDF membranes and probed with M2 anti-FLAG antibody (Sigma; 1 in 5,000 dilution) and HRP-conjugated goat anti-mouse antibody (1 in 250,000 dilution) ...
-
bioRxiv - Neuroscience 2022Quote: Rabies injected brains were immunohistochemically stained using antibodies against the 2A linker protein (Merck/ Millipore, ABS31, 1:2000) found in tTA expressing cells ...
-
bioRxiv - Neuroscience 2022Quote: ... and immunoblotted for protein expression using the following antibodies: guinea pig anti-GLT1 at 1:25,000 (Millipore AB1783) and mouse anti-beta actin at 1:20,000 (Sigma-Aldrich A1978) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein loading was measured using a monoclonal β-actin antibody directly conjugated to horseradish peroxidase (A3854, Sigma-Aldrich) and imaged as above.
-
bioRxiv - Molecular Biology 2021Quote: ... and proteins (0.5-1 mg) were precipitated using the anti-FLAG antibody (1:100, Cat. #F7425; Sigma-Aldrich), anti-HA antibody (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies for another series included rat anti-glial fibrillary acidic protein (1:2500, AB5804, Millipore, Lot # TA265137) or goat anti-Iba1 (1:1000 ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were detected by western blotting using either Anti-FLAG M2 monoclonal antibody-peroxidase conjugate (Sigma, A8592) at a dilution of 1:10000 ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were transferred to PVDF membrane and probed with M2 anti-FLAG antibody (Sigma; 1 in 1,000 dilution) and HRP-conjugated goat anti-mouse antibody (1 in 250,000 dilution) ...
-
bioRxiv - Microbiology 2021Quote: ... Bound proteins were detected by western blot using anti-His antibody and streptavidin-HRP conjugate (SIGMA, reference GERPN1231).
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were transferred onto a Protran nitrocellulose membrane and probed with antibody clone 12D10 against puromycin (Millipore MABE343). Subsequently ...
-
bioRxiv - Genomics 2021Quote: ... Primary antibodies against the following proteins were used: SOX9 (1:50, AF3045, R&D Systems, and AB5535, Millipore), ERG (1:50 ...
-
bioRxiv - Biochemistry 2021Quote: ... and the immunoprecipitated proteins were subjected to SDS-PAGE and immunoblotting with anti-Flag antibody (Cat# F1804, Sigma), anti-HA antibody (Cat # H6908 ...
-
bioRxiv - Microbiology 2021Quote: ... and SARS2-71 [40] anti-S protein antibodies and HRP-conjugated goat anti-mouse IgG (Sigma Cat # A8924) in PBS supplemented with 0.1% saponin and 0.1% bovine serum albumin ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies against the following proteins were used at indicated dilutions: anti-acTub (Sigma-Aldrich T7451, mouse 1:2,000), anti-Arl13b (Proteintech 17711-1-AP ...
-
bioRxiv - Microbiology 2021Quote: ... The localisation of the codon-optimised NS5 protein was detected with a rabbit-anti-FLAG antibody (Sigma, Germany).
-
bioRxiv - Cancer Biology 2022Quote: ... Ras protein level in the pull down was analyzed by by immunoblotting using RAS antibody (Sigma-Aldrich #OP40). Total was lysate was also subjected to immunoblotting to determine RAS expression level as the input.
-
bioRxiv - Molecular Biology 2023Quote: ... An equivalent amount of protein lysate was subjected to SDS-PAGE and immunoblotting with antibodies against FLAG (Sigma), V5 (Cell Signaling ...
-
bioRxiv - Microbiology 2023Quote: ... Protein was detected using HRP-conjugated anti-mouse secondary antibody (Amersham) and Luminata Forte Western HRP substrate (Millipore).
-
bioRxiv - Biochemistry 2023Quote: ... the proteins bound to the Flag antibodies were eluted using 400 µg/mL of 3xFlag peptide (Sigma, F4799) during 30 min at 4°C under agitation ...
-
bioRxiv - Genetics 2023Quote: ... Immunoprecipitation was performed on total-protein lysate using 1 μg of rabbit polyclonal TTC29 antibody (HPA061473, Sigma-Aldrich) and 15 μl of Protein A/G magnetics beads (Bio-Ademtec ...
-
bioRxiv - Microbiology 2023Quote: ... and cells were probed using primary antibodies to VZV proteins IE62 (mouse mAb; EMD Millipore MAB8616; 1:200), capsid-ORF23 (polyclonal rabbit ...
-
bioRxiv - Molecular Biology 2024Quote: ... or with 1-5 μg of the appropriate antibody and then with Protein G Sepharose beads (Sigma, P3296). The following day ...
-
bioRxiv - Cell Biology 2024Quote: ... Target proteins were probed using their respective antibodies (Table S1) in 5% Bovine Serum Albumin (BSA, Sigma-Aldrich) overnight at 4°C ...
-
bioRxiv - Neuroscience 2024Quote: 10 µg of protein was loaded per sample and membrane was probed with antibodies against APOE (Sigma; AB947), RHEB (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... the primary antibody was glial fibrillary acidic protein (GFAP) (1:1000 dilution; Millipore, Temecula, CA, USA; Cat. #MAB360). Secondary antibodies were conjugated to Alexa Fluor 594 (donkey anti-mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mg of proteins were subsequently incubated for 1h with 10 μl of FAM134B or FAM134C antibodies (Sigma Prestige-HPA012077 and -HPA016492 ...
-
bioRxiv - Neuroscience 2022Quote: ... for 2 hours and subsequently incubated with Dynabeads Protein G and an anti-Flag antibody (Sigma-Aldrich, F1804) at 4°C with rotation for 2 hours ...
-
bioRxiv - Biochemistry 2022Quote: ... Western blotting was performed using a α-4HNE antibody specific to the Michael protein adduct (EMD Millipore Corp.) at a dilution of 1:1000 antibody over night at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... The presence of over-expressed protein was confirmed using monoclonal anti-poly histidine alkaline phosphatase antibody (Sigma-Aldrich) at 1:20,000 dilution.
-
bioRxiv - Biochemistry 2022Quote: ... The expression of the proteins was assessed by western blot using antibodies raised against the T7 epitope (Novagen) and GAPDH (Abcam).
-
bioRxiv - Pathology 2024Quote: ... 0.5% Triton and lysates were incubated with rabbit or mouse isotypic control antibodies and G-protein beads (Sigma) for 1 hr at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Changes in HCoV-OC43 spike protein expression were assessed using mouse monoclonal antibody 541-8F (Sigma-Aldrich, MAB9012). The effect of the compound on influenza A virus NS1 non-structural or nucleoprotein expression was measured using rabbit anti-influenza A virus NS1 nonstructural protein antibody (GeneTex ...
-
bioRxiv - Neuroscience 2020Quote: ... Iba1 (rabbit, WAKO;, RRID: AB_839504) were visualized by avidin-biotin technique with 3,3-diaminobenzidine (DAB, Sigma) according to standard procedures of the UKE Mouse Pathology Facility using the ultraView Universal DAB Detection Kit (Ventana) ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Additional blocking by incubation with avidin and biotin (both 0.001% in PB, Sigma-Aldrich, Darmstadt, Germany) for 30 min and a 10 min wash with PBST in between were carried out before incubation with the blocking solution ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by avidin-biotin complex and developed in solution containing 0.025% 3,3’-diaminobenzidine tetrahydrochloride (Sigma-Aldrich), 10 mM imidazole ...
-
bioRxiv - Cell Biology 2022Quote: ... Tubes were kept at 37°C in a water bath and D-biotin (B4501; Sigma-Aldrich) was added at a final concentration of 500 μm ...
-
bioRxiv - Cell Biology 2020Quote: The mixture was incubated with Dibenzocyclooctyne-PEG4-biotin conjugate (Sigma-Aldrich #760749; 50 μM final concentration) in a reaction volume of 100 μl for 1 h on a rotator in slow motion (9 rpm ...