Labshake search
Citations for Millipore Sigma :
151 - 200 of 10000+ citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... The mouse VDAC1-specific shRNA sequence 2 GTTGGCTATAAGACGGATGAACT (Sigma-Aldrich, Ref. #TRCN0000012391), the VDAC1 shRNA sequence 3 ACCAGGTATCAAACTGACGTTCT (Sigma-Aldrich ...
-
bioRxiv - Genomics 2021Quote: ... Monoclonal mouse Anti-Stage-Specific Embryonic Antigen-4 Antibody (Millipore, MAB4304,1:100), Polyclonal Goat Anti- Human/Mouse Oct-3/4 Antibody (R&D System ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse antibody specific for human SOD1 (SD-G6 1:100, Millipore Sigma), Mouse anti-human HSP70 specific for stress-inducible HSPA1A (SMC-100B 1:100 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The levels of Aβ40 and Aβ42 were quantified by sandwich ELISA using Aβ40 and Aβ42 EZbrain ELISA kit (EMD Millipore) following the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2023Quote: FGF21 ELISA was performed following the manufacturer’s guidelines (FGF21 ELISA kit, Millipore Sigma catalogue number-EZRMFGF21-26K).
-
bioRxiv - Physiology 2024Quote: ... Plasma total ghrelin was measured by mouse/rat ELISA (EZRGRT-91K, Millipore). All samples were run in duplicate ...
-
bioRxiv - Physiology 2022Quote: ... total adiponectin by ELISA kit EZMADP-60K (EMD Millipore), high molecular weight (HMW ...
-
bioRxiv - Physiology 2020Quote: ... Insulin was measured in plasma by ELISA kit (Millipore). For IP-GTT (2 g/kg ...
-
bioRxiv - Biochemistry 2023Quote: ... previously quantified via a human ANGPTL4 ELISA kit (Sigma).
-
bioRxiv - Cell Biology 2023Quote: ... The Anti-human IGFBP2 ELISA kit (Sigma, #RAB0233-1KT) was used to quantify IGFBP2 protein in the supernatants according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... Fam72a+/+ CH12 cells (20 × 104 cells/mL) were cultured 20 hours with 10uM of CDK1/cyclin B1 inhibitor RO-3306 (Sigma), followed by exchange into inhibitor-free culture media ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse Tubulin (clone B-5-1-2 from Sigma, 1:5000), rabbit ZW10 (ab21582 from abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse monoclonal antibody was b-actin (clone AC-15, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2020Quote: ... and mouse anti-b-actin (1:5000, Sigma, Cat No A5441), in PBS with 0.05% Tween-20 and 10% Odyssey blocking buffer at 4°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... and mouse anti-actin B (Sigma-Aldrich, St. Louis, MO, USA).
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti–α-Tubulin clone B-512 (1:2,000:Sigma-Aldrich), rabbit anti–β-Tubulin (1:2,000 ...
-
bioRxiv - Genomics 2023Quote: ... mouse α-tubulin (1:10,000, B-5-1-2, Sigma Aldrich). Secondary HRP-conjugated antibodies (Sigma Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... with the same combination of primary and secondary antibodies: mouse anti-acetyl-alpha tubulin antibody clone 6-11-B1 (Sigma⍰Aldrich) at a 1:100 dilution and rabbit anti-HA tag antibody (Cell Signalling Technology ...
-
bioRxiv - Microbiology 2024Quote: ... The following mixture of primary antibodies was used: a mouse anti-acetyl-alpha tubulin antibody clone 6-11-B1 (Sigma⍰Aldrich) at a 1:100 dilution and a rabbit anti-HA tag antibody at a 1:50 dilution (Cell Signalling Technology) ...
-
bioRxiv - Cell Biology 2022Quote: ... After 24-hours BrdU was added to the media and 16h later cell proliferation was evaluated using the BrdU Cell Proliferation ELISA kit (EMD-Millipore). Colorimetric analysis was done with single channel 450nm intensity ...
-
bioRxiv - Immunology 2020Quote: ... IL-17A and TNFα were quantified in culture supernatants using the mouse-specific Milliplex® multi-analyte panel kit MT17MAG-47K (Millipore; Sigma) and the MagPix® instrument platform with related xPONENT® software (Luminex Corporation) ...
-
bioRxiv - Immunology 2022Quote: ... Cultures were stimulated with 20 ng/ml PMA for 3 hours and assessed with a mouse IFN-γ ELISA kit (Sigma-Millipore). For airway epithelial cell culture ...
-
bioRxiv - Physiology 2021Quote: ... extra blood was collected at each time-point and later plasma was separated by centrifugation (15min at 2,000 RPM) and stored at −80 °C for insulin measurement using a Rat/Mouse Insulin Elisa kit (EMD Millipore - EZRMI13K). Prior to sacrifice ...
-
bioRxiv - Cell Biology 2021Quote: ... The supernatants were then used to quantify the level of adiponectin using Mouse Adiponectin ELISA kit (Merck Millipore #EZMADP-6 K) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... the supernatant and the fasting and 15 min GTT serum was performed using Rat/Mouse Insulin ELISA kit (EZRMI-13K, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: Protein-protein interaction was measured by PLA with Duolink In Situ Orange Starter Kit Mouse/Rabbit (DUO92102, Millipore Sigma) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines tested and confirmed to be mycoplasma free using the Mycoplasma PCR ELISA kit (Sigma). CENP-A overexpression was induced by the addition of Dox to typical growth media at 10ng/ml (considered 1X) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Albumin was measured in the cell culture medium by Human ALB/Serum albumin ELISA Kit (Sigma-Aldrich) and in the cell lysate by qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... Following amplification cells were washed for 15 min with wash buffer B (Sigma Duolink PLA kit) and incubated with Hoechst for 5 min before another 15 min wash with buffer B ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5 U ml−1 amphotericin B1 (all Sigma Aldrich). The skin was then dissected into 2-3 mm2 pieces using a surgical scalpel and 3 or 4 pieces placed per well of a 6-well dish (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2019Quote: ... and acetylated-α-tubulin (1:5000; Sigma 6-11-B1). Conjugated secondary antibodies were purchased from Invitrogen Life Technologies (Carlsbad ...
-
bioRxiv - Plant Biology 2022Quote: ... and anti-Mouse IgG (Fc-specific)-Peroxydase (Sigma, dilution: 1/10000, 1.5hr incubation). Anti-Hsp90 (Agrisera ...
-
bioRxiv - Physiology 2021Quote: ... or peroxidase-conjugated anti-mouse IgG (Fab Specific) Ab (Sigma A2304; 1:200’000). The immuno-positive bands were visualized by chemiluminescence using the WesternBright ECL-HRP Substrate (Witec AG) ...
-
bioRxiv - Neuroscience 2022Quote: ... The final measurements were normalized to protein content using sulforhodamine B (Sigma) (Johnson et al. ...
-
bioRxiv - Physiology 2024Quote: ... Plasma active (acylated) ghrelin was measured by mouse/rat ELISA (EZRGRA-90K, Millipore). Plasma total ghrelin was measured by mouse/rat ELISA (EZRGRT-91K ...
-
bioRxiv - Immunology 2023Quote: ... cells in B cell media were fixed with formaldehyde (Sigma) at final concentration of 1% for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... Absolute OVA-specific IgG1 concentration was determined for each sample by ELISA as described above using OVA-14 (Sigma, MO USA) as a standard and equalized across all samples ...
-
bioRxiv - Biochemistry 2020Quote: ... Incubation with kit-specific secondary antibodies (anti-rabbit MINUS Sigma Cat ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibody (Mouse Anti-Influenza A NP, Millipore MAB8251 or Mouse Anti-Influenza B NP, Millipore MAB8661) was diluted 1:4000 in antibody diluent ...
-
bioRxiv - Immunology 2020Quote: ... IL-17A and TNFα were quantified in culture supernatants using the mouse-specific Milliplex® multi-analyte panel kit MT17MAG-47K (Millipore; Sigma) and the MagPix® instrument platform with related xPONENT® software (Luminex Corporation) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human c- peptide ELISA kit (cat # EZHCP-20K, Millipore MA), Human Insulin ELISA kit (cat # ELH- Insulin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: A commercial kit (Rat RAGE/AGER ELISA, #RAB0009, Sigma-Aldrich) was used to quantify RAGE levels ...
-
bioRxiv - Microbiology 2024Quote: ... and the Bovine IFN-alpha ELISA Kit (Sigma-Aldrich, RAB1012) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Cultures were stimulated with 20 ng/ml PMA for 3 hours and assessed with a mouse IFN-γ ELISA kit (Sigma-Millipore). For airway epithelial cell culture ...
-
bioRxiv - Immunology 2023Quote: ... The supernatant was collected and serum insulin levels were determined in triplicate using a rat/mouse insulin Enzyme-Linked Sorbent Assay (ELISA) kit from Millipore (EZRMI-13K) according to the instructions of the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... and tubulin antibody (1:3000 dilution, B-512, mouse monoclonal, Sigma-Aldrich), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-alpha-tubulin ([B-5-1-2], Sigma, T5168, RRID AB_477582) and ATTO647N-conjugated anti-GFP nanobodies (GFPBooster-ATTO647N ...
-
bioRxiv - Cancer Biology 2019Quote: ... α-tubulin mouse (1:10000 WB, clone B-5-1-2, Sigma-Aldrich), p120 catenin mouse (1:1000 WB ...