Labshake search
Citations for Millipore Sigma :
1 - 50 of 10000+ citations for Mouse Marginal Zone B And B1 Cell Specific Protein MZB1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-Lamin B1 (A5316, Sigma-Aldrich), mouse anti-β-actin (A2228 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cyclin B1 (mouse mAb; Millipore, 05-373), pT320 PPP1CA (rabbit mAb ...
-
bioRxiv - Physiology 2021Quote: ... then incubated with the primary anti-MZB1 antibody (polyclonal, Sigma-Aldrich) overnight at 4C ...
-
bioRxiv - Physiology 2021Quote: ... mouse FGF21 ELISA kit (Sigma-Aldrich, EZRMFGF21-26K).
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse IL-6 ELISA kit (Sigma, RAB0309), anti-mouse G-CSF ELISA kit (MCS00 ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Genomics 2023Quote: ... and Cap B (B1:B2 1:1; BI0347-0505, BI0349-0505 Sigma-Aldrich) reagents ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Serum insulin levels were determined by ELISA using mouse insulin ELISA kit from Sigma according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... mouse GLP-1 ELISA kit (EZGLP1T) from Sigma-Aldrich; mouse GDF15 ELISA kit (DY6385 ...
-
bioRxiv - Biophysics 2019Quote: CH27 mouse B-cells (Millipore Cat# SCC115, RRID:CVCL_7178), a lymphoma-derived cell line (Haughton et al. ...
-
bioRxiv - Biophysics 2022Quote: CH27 B-cells (mouse, Millipore Cat# SCC115, RRID:CVCL_7178), a lymphoma-derived cell line (21 ...
-
bioRxiv - Biophysics 2022Quote: CH27 B-cells (mouse, Millipore Cat# SCC115, RRID:CVCL_7178), a lymphoma-derived cell line (Haughton et al. ...
-
bioRxiv - Physiology 2021Quote: ... then incubated overnight at 4C with the following primary antibodies: anti-MZB1 (Sigma-Aldrich), anti-CD38 (Santa-Cruz Biotechnology) ...
-
bioRxiv - Cell Biology 2022Quote: Blocking component 1 (B1): 1 mg/ml mouse IgG (Sigma) in S2.
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-microtubule-associated protein 2a+b (MAP2, Sigma #M1406; 1:2000), rabbit anti-tyrosine hydroxylase (TH ...
-
bioRxiv - Biochemistry 2022Quote: ... S5H recombinant protein was examined by using specific anti-His mouse antibody (Novagen) as described in (López-Gresa et al. ...
-
bioRxiv - Physiology 2020Quote: ... and each circulating hormones were determined using a commercially available ELISA kit for total ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-91K, Millipore), and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit ...
-
Cholesterol deprivation induces TGFβ signaling to promote basal differentiation in pancreatic cancerbioRxiv - Cancer Biology 2019Quote: The amount of Shh secreted by mouse pancreatic tumor cells was quantified by using the Mouse Shh-N ELISA Kit (#RAB0431, Millipore), according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2021Quote: ... or cell culture supernatants were quantified by ELISA methods (Activin A ELISA kit, Sigma, St ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were incubated overnight at 4 °C with antibodies that recognise specific proteins expressed by each cell type such as mouse anti-NeuN (1:250; Millipore) to label neurons ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-cyclin B1 (Clone GNS3; 1:2000; Merck Millipore 05-373), mouse anti-cyclin A2 (clone BF683 ...
-
bioRxiv - Physiology 2021Quote: ... Plasma FGF21 was assayed using the rat/mouse FGF21 ELISA kit (Sigma) according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: ... and active ghrelin (Rat/Mouse Total Ghrelin ELISA kit, EZRGRT-90K, Millipore). All procedures were performed by following the manufacturer’s protocol.
-
bioRxiv - Genetics 2021Quote: ... Mouse plasma insulin and leptin levels were determined by using Rat/ Mouse Insulin ELISA Kit (Millipore, EZRMI-13K for insulin and EZML-82K for leptin ...
-
bioRxiv - Immunology 2022Quote: Protein lysate was extracted using CelLytic B Cell Lysis Reagent (Sigma) following the manufacturer’s instruction ...
-
bioRxiv - Genetics 2019Quote: ... mouse anti-acetylated tubulin (clone 6-11-B1, Sigma-Aldrich, T6793; 1:1,000), mouse anti-ARL13B (UC Davis NeuroMab 75-287 clone N295B/66 ...
-
bioRxiv - Cell Biology 2019Quote: ... and rat/mouse c-peptide ELISA kit (cat # EZRMCP 2-21K, Millipore MA).
-
bioRxiv - Cell Biology 2019Quote: ... The CRP concentration in mouse serum was measured using the mouse CRP ELISA kit (Sigma-Aldrich, RAB1121) according to the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... media was collected and used to measure secreted Cxcl1 protein on an ELISA plate according to the KC/Cxcl1 ELISA kit manufacturer’s instructions (Sigma-Aldrich #RAB0117). Absorbance values at 450 nm were measured with a Tecan plate reader ...
-
bioRxiv - Plant Biology 2024Quote: ... total RNA extraction from inter-pathogen zone was carried out using an RNAeasy kit from Sigma Aldrich, and the RNA quality was evaluated using a Nanodrop spectrophotometer ND1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-mouse light chain specific (Millipore AP200P), anti-rabbit (Fisher 31462) ...
-
bioRxiv - Microbiology 2021Quote: ... Insulin was measured using the rat/mouse insulin ELISA kit from Millipore (EZRMI-13K), according to the manufacturer’s instructions (Wang et al. ...
-
bioRxiv - Developmental Biology 2022Quote: GH was measured using a mouse/rat growth hormone ELISA kit (Millipore – EZRMGH-45K), based on quantitative sandwich enzyme immunoassay technique ...
-
bioRxiv - Physiology 2021Quote: ... Insulin was measured by ELISA (EZRMI-13K Sigma-Aldrich - Rat/Mouse - Insulin ELISA) and the hepatic and skeletal muscle glycogen contents of fed rats (Lo et al ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse anti-ACTIN B (Sigma Aldrich), goat anti-LAMIN B (Santa Cruz) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-ACTIN B (Sigma-Aldrich), rabbit anti-ACTIN B (Cell signalling) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse Map2a+b (Sigma #M1406) 1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse anti-b-actin (Sigma) at 1:5000 in TBS blocking buffer (LI-COR Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies used for protein quantification for ELISAs were mouse monoclonal anti-His (His-Tag mAb, EMD-Millipore), and biotinylated mouse anti-rat Cd4 (clone OX68) ...
-
bioRxiv - Neuroscience 2021Quote: ... Antibodies specific for cell type specific markers: GFAP (Millipore, Clone GA5 ...
-
bioRxiv - Cell Biology 2020Quote: si-lamin B1 (UUCCGCCUCAGCCACUGGAAAU, Sigma)
-
bioRxiv - Cell Biology 2020Quote: ... Cyclin B1 (Millipore; 05-373), PPP1CA (Bethyl ...
-
bioRxiv - Cell Biology 2023Quote: ... Fumonisin B1 (FB1, Merck Sigma) treatment was performed on 5-day old seedlings grown on normal ½ MS plates that were transferred for 16 hours into multiwall plates containing liquid ½ MS medium with 2.5 µM FB1 ...
-
bioRxiv - Biochemistry 2023Quote: ... or fumonisin B1 (Sigma-Aldrich). Proteins were heated from 20 °C to 95 °C ...
-
bioRxiv - Physiology 2024Quote: ... where the astrocyte-specific red fluorescent dye sulforhodamine B (10 mg/ml, Sigma) was intraperitoneally injected into awake mice at a dose of 10 μL/g ...
-
bioRxiv - Molecular Biology 2019Quote: ... FLAG-CTCF-6xHis protein was induced in Rosseta-Gami B-cells (EMD Millipore) with 0.2 M of IPTG at room temperature and was purified with Ni-NTA resin (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... A GST-Drn fusion protein was produced in Origami B (DE3) cells (Novagen) and purified with a glutathione-Sepharose 4B column ...
-
bioRxiv - Physiology 2020Quote: Insulin concentrations were measured by ELISA (EZRMI-13K Rat/Mouse insulin ELISA, Merck Millipore) according to the manufacturer’s instructions ...
-
ARID1a protects against steatosis and insulin resistance via PPARalpha-mediated fatty acid oxidationbioRxiv - Cell Biology 2019Quote: ... Insulin plasma levels were determined using mouse insulin ELISA kit (Millipore, St. Charles, MO, US). The levels of the serum inflammatory indicators were measured by ELISA (BD Bioscience ...
-
bioRxiv - Immunology 2022Quote: ... TNFa and CTX-I were measured using the mouse SAA-3 ELISA kit (Sigma-Aldrich), LEGEND MAX™ Mouse TNF-α ELISA Kit (BioLegend ...