Labshake search
Citations for Millipore Sigma :
1901 - 1950 of 10000+ citations for 2 1H Imidazol 1 yl 6 methyl 4 pyrimidinemethanamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... acetylated α-tubulin (mAb 6-11B-1 T6793; Sigma-Aldrich;), S tag (EMD Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... 2019-nCoV_N1 Probe (6-FAM / BHQ-1) ACCCCGCATTACGTTTGGTGGACC (Sigma Aldrich) for amplifying RNA from the SARS CoV-2 N-1 gene ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used included acetylated tubulin (6-11B-1, Sigma), MmIFT27 (33 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 mL of 1% crystal violet (CV) solution (Sigma-Aldrich) was added to the well and incubated for 15 min at 25 °C ...
-
bioRxiv - Physiology 2024Quote: ... or acetylated Tubulin (T7451, clone 6-11B-1; Sigma-Aldrich ) at 4° C ...
-
bioRxiv - Cell Biology 2024Quote: ... Then primary mouse monoclonal antibody 6-11B-1 (Millipore Sigma) diluted 1:50 followed by secondary rat-absorbed Alexa 568-conjugated donkey anti-mouse antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-mouse acetylated-tubulin (6-11B-1, Sigma-Aldrich), mouse anti-mouse γ-tubulin (GTU-88 ...
-
bioRxiv - Immunology 2024Quote: ... Alexa Fluor 488 anti-acetylated tubulin (6-11B-1; Sigma), Alexa Fluor 488 DNAse 1 (Invitrogen) ...
-
bioRxiv - Plant Biology 2024Quote: ... 6% v/v Triton X-100 (EMD Millipore #TX1568-1) added by pipetting for a final concentration of 1% TX-100 ...
-
bioRxiv - Physiology 2024Quote: ... Sildenafil (6 µg•g-1 body weight; PHR1807, Millipore Sigma) versus vehicle (volume matched injection ...
-
bioRxiv - Microbiology 2024Quote: ... and 6-Chloropurine riboside (99%, Sigma-Aldrich 5399-87-1) were formulated in DMSO for testing at 125 μM and 250 μM ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1 mg/ml 6-aminocaproic acid (ACA, Sigma-Aldrich). 3D-bioprinted fibers were stimulated with a set of carbon-made electrodes attached to the cover of a Petriunder an inverted microscope (Leica’s DMi8 ...
-
bioRxiv - Biochemistry 2024Quote: ... K40: mouse monoclonal (Sigma T7451, clone 6-11 B-1), recognizes acetylation of α-tubulin on Lys residue ...
-
bioRxiv - Cell Biology 2020Quote: ... BSA was coupled to the PEG (3000) for 1h at RT with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 100 mM, Sigma Aldrich, 39391) and N-hydroxy-succinimide (NHS ...
-
bioRxiv - Neuroscience 2020Quote: ... The next day sections were washed in PBS and incubated for 1h with A488-conjugated secondary donkey anti-goat antibody (1:500, EMD Millipore, USA). Sections were then washed in PBS and blocked with 10% normal goat serum (Dako ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and blocked for 1h in 3% BSA (Fisher bioreagents CAS 9048-46-8) and 0.1% Triton X-100 (Sigma 9002-93-1). The cells were then incubated in primary antibody overnight ...
-
bioRxiv - Physiology 2022Quote: ... methyl α-D-glucopyranoside (both from Sigma-Aldrich, Saint Luis, MI, USA) were added to the extraction buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... Compounds used in these studies included N-methyl-D-aspartate (NMDA; Sigma; 1.5 ul at concentration of 100mM in PBS) ...
-
Mechanisms of Coupling between Angiotensin Converting Enzyme 2 and Nicotinic Acetylcholine ReceptorsbioRxiv - Neuroscience 2021Quote: ... 15 mM methyl-β-cyclodextrin (MβCD; Sigma Chemical, St. Louis, MO, USA), 5 μM cytochalasin B (CytoB ...
-
bioRxiv - Biophysics 2021Quote: ... 0.2% (v/v) methyl cellulose (M0512, Sigma-Aldrich Chemie B.V., the Netherlands), 75 mM KCl ...
-
bioRxiv - Microbiology 2021Quote: ... and motility medium with MeAsp (α-methyl-DL-aspartate; Sigma-Aldrich M6001) at concentrations of 0–460 μM in the right channel ...
-
bioRxiv - Neuroscience 2020Quote: ... cleared in methyl salicylate (35 min; M-2047; Sigma Aldrich, Steinheim, Germany) and mounted in Permount (Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... then immersed in propylene glycol methyl ether acetate (PGMEA, Sigma Aldrich, 484431) for 5 minutes to dissolve un-crosslinked photoresist ...
-
bioRxiv - Neuroscience 2022Quote: Methyl-tert-butyl-ether (MTBE) and chloroform were purchased from Sigma Aldrich; methanol was from Fisher Science Education ...
-
bioRxiv - Neuroscience 2022Quote: ... 40 μl of N-Methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA; 69478, Millipore Sigma) was added and the vial placed in a Benchmark Multi-Therm heat shaker set at 40°C and 250 rpm ...
-
bioRxiv - Neuroscience 2020Quote: Fluorescent cationic probe tetramethylrhodamine methyl ester (TMRM) (Sigma-Aldrich, St Louis, USA) was used to evaluate the ΔΨ ...
-
bioRxiv - Immunology 2020Quote: ... Methyl-beta-cyclodextrin (MβCD) and MβCD-coated cholesterol were purchased from Sigma.
-
bioRxiv - Cell Biology 2021Quote: ... N omega-nitro-L-arginine methyl ester hydrochloride (L-NAME; 0.15mM; Sigma), N-([3-(aminomethyl)phenyl] methyl ...
-
bioRxiv - Physiology 2023Quote: A solution of 10 μM palmitoyl-L-carnitine-(N-methyl-d3) (Sigma), 10 μM palmitic acid-d31 (Sigma) ...
-
bioRxiv - Biophysics 2023Quote: ... the master was developed in propylene glycol methyl ether acetate (Sigma-Aldrich) to remove any photoresist which had not cross-linked ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... NaCl was replaced with 110 mM N-methyl-D-glucamine (NMDG, Sigma)and 15 mM Tris-base ...
-
bioRxiv - Immunology 2023Quote: ... PTC-028 (Sapphire Bioscience) was dissolved in 0.5% Methyl cellulose (Sigma-Aldrich) 1% Tween 80 (MPBio ...
-
bioRxiv - Cell Biology 2023Quote: ... and methyl jasmonate were purchased from Sigma-Aldrich (St. Louis, MO, USA). Prostaglandin E2 was purchased from Tocris (Abingdon ...
-
bioRxiv - Physiology 2023Quote: ... 1mL of 250mM Paraquat (Methyl viologen dichloride hydrate, 856177-1G, Sigma Aldrich) solution was added to the 60 mm NGM plates and plates were put on a shaker for 1 hour ...
-
bioRxiv - Neuroscience 2022Quote: ... Compounds used in these studies included N-methyl-D-aspartate (NMDA; Sigma; 1.5 µl at concentration of 100mM in PBS) ...
-
bioRxiv - Biophysics 2022Quote: ... the master was developed in propylene glycol methyl ether acetate (Sigma-Aldrich) to remove any photoresist which had not cross-linked.
-
bioRxiv - Biochemistry 2023Quote: ... and Heptakis(2,6-di-O-methyl)-β-cyclodextrin (Sigma-Aldrich, 39915-1G). The assays were measured at different time points (2d ...
-
bioRxiv - Cell Biology 2023Quote: ... were treated for 45 min with 1.5% methyl-β-cyclodextrin (MβCD, Sigma) in DMEM/F-12 to deplete cellular cholesterol ...
-
bioRxiv - Biophysics 2023Quote: ... the master was developed in propylene glycol methyl ether acetate (Sigma-Aldrich) to remove any photoresist which had not cross-linked.
-
bioRxiv - Immunology 2024Quote: ... Nuclei were stained with methyl green (Sigma-Aldrich, St. Louis, MO, USA) and mounted onto a slide containing fluorescence mounting media (Dako ...
-
bioRxiv - Systems Biology 2024Quote: ... or methyl methanosulfonate (MMS, 0.02% v/v; 66-27-3, Sigma-Aldrich).
-
bioRxiv - Neuroscience 2024Quote: ... Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME, Sigma-Aldrich, N5751), BIBP3226 (1 µM ...
-
bioRxiv - Cancer Biology 2024Quote: ... and further diluted in 0.5% (hydroxypropyl)methyl cellulose (HPMC) solution (Sigma-Aldrich). The dosing solution was sonicated for 20 minutes prior to administration ...
-
bioRxiv - Cell Biology 2024Quote: ... 650 μl of distilled methyl-tert-butylether (MtBE, Sigma-Aldrich, HPLC grade) and 100 μl of internal standard solution (5α-cholestane in MtBE ...
-
bioRxiv - Cell Biology 2023Quote: ... N=4 (2 females, 2 males) mice were given 12.5 mg/kg sodium nitrite (52mg/L, 23713, Sigma) in 10% blackcurrant squash (Robinsons) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: A total of 150 µL of 3% 4-ethoxymethylene-2-phenyl-2-oxazolin-5-one (oxazolone; Sigma-Aldrich) dissolved in 100% ethanol (Wako ...
-
bioRxiv - Physiology 2022Quote: ... 0.5M K4[Fe(CN)6] and 0.5M K3[Fe(CN)6] with 1 mg/ml X-Gal diluted in DMF (all Sigma)) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cre-mediated recombination was induced in embryos by intraperitoneal injection of 0.5 mg (Cdh5-CreERT2) or 2 mg (Vegfr1-CreERT2, Vegfr3-CreERT2) of 4-hydroxytamoxifen (4-OHT, H7904, Sigma), dissolved in peanut oil (10 mg/ml) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Male C57Bl/6J mice were treated with 5% 4-MU (Alpha Aesar) and 2 mg/ml 4-MUG (Sigma) starting at 8 weeks of age for 20 days ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Male C57Bl/6J mice were treated with 5% 4-MU (Alpha Aesar) and 2 mg/ml 4-MUG (Sigma) starting at 8 weeks of age and maintained on this diet until they were euthanized ...