Labshake search
Citations for Millipore Sigma :
1751 - 1800 of 3147 citations for 6 ISOPROPYLINDOLE 97 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... Slides were inserted into a 1 μg/ml solution of 4’,6-diamidino-2-phenylindole (DAPI, Sigma) for 10s and ...
-
bioRxiv - Biophysics 2022Quote: ... (6)) by using anti-Flag coupled beads (Pierce, #A36797) for Src precipitation and anti-Flag (M2, Sigma) and anti-Myc (9B11 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse monoclonal antibodies: anti-acetylated α-tubulin (AcTub) (Sigma, T7451, clone 6-11B-1, IF: 1:10,000), anti-α-tubulin (Proteintech ...
-
bioRxiv - Immunology 2022Quote: ... as the mobile phase on the Superose 6 Increase 10/300 GL (Millipore Sigma, 29-0915-96). Fractions were analyzed by SDS-PAGE to identify those containing gH/gL >95% purity based on Coomassie blue staining ...
-
bioRxiv - Cell Biology 2022Quote: ... contained in a 6-well plate were coated with poly-D-lysine (50 ng/ml, Sigma, P6407) for 1-2 h at 37°C after which the poly-D-lysine was removed ...
-
bioRxiv - Developmental Biology 2022Quote: ... a mouse monoclonal anti-acetylated tubulin clone 6-11B-1 antibody (IgG2b; product T 6793; Sigma-Aldrich) were used at 1:2,500 dilution and secondary anti-mouse isotype-specific antibody conjugated with Alexa 488 (anti-IgG2b ...
-
bioRxiv - Cell Biology 2022Quote: ... nuclei were counterstained with 500 ng/mL of 4′,6-diamidino-2-phenylindole (DAPI, Sigma, CAT#D8417) for 10 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... then dehydrated through a PBS/methanol gradient and bleached with 6% (vol/vol) hydrogen peroxide (H1009, Sigma) in methanol overnight at 4° C ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were stained with DAPI (4’,6-diamidino-2-phenylindole; Sigma-Aldrich Corp., St. Louis, MO, USA) and cover slipped with Fluoromont-G ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were seeded in 6-well plate (100,000 to 150,000) and infected in the presence of 8μg/ml polybrene (Sigma). Cells were selected in medium containing 3μg/ml puromycin (Sigma ...
-
bioRxiv - Biophysics 2020Quote: Unsized unilamellar DOPG liposomes containing Laurdan (6-Dodecanoyl-N, N-dimethyl-2-naphthylamine, from Sigma, Taufkirchen, Germany) (molar ratio lipid:Laurdan=1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were washed 1x and incubated with 0.2µg/mL DAPI (4’,6-diamidino-2-phenylindole, Sigma-Aldrich) for 10min at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 6 μg of female-derived competitive DNA and 50 µg of sonicated salmon sperm DNA (Sigma-Aldrich). Each ethanol-precipitated probe mixture was dissolved in 20 μL of the hybridization buffer (for composition ...
-
bioRxiv - Cancer Biology 2022Quote: ... A methylcellulose stock solution was prepared by dissolving 6 grams of autoclaved methylcellulose powder (M0512 Sigma-Aldrich) into 250 ml of preheated (60°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 weeks old mice in the 4NQO group were given 100ug/ml of 4NQO (Sigma-Aldrich, #N8141), a water soluble chemical carcinogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... native fluorescence was quenched after immunostaining by overnight incubation with methanol containing 6% hydrogen peroxide (H1009, Sigma) at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... adult (6-8-wk-old) Lrig1-CreERT2/+;Apc-flox/+ mice were intraperitoneal-injected with 2mg tamoxifen (Sigma) in corn oil for 3 consecutive days ...
-
bioRxiv - Developmental Biology 2019Quote: ... 6×His-tagged protein were expressed and purified by Ni-NTA His Bind Resin (Millipore 70666-3). ∼0.2 μg of GST-OsBZR1 ...
-
bioRxiv - Systems Biology 2019Quote: ... Slides were dried for 6 min and subsequently incubated at room temperature with Wright stain (Sigma-Aldrich) for 8 mins ...
-
bioRxiv - Immunology 2019Quote: ... Then cells were stained with a 1/15000 dilution of 4’,6-diamidino-2-phenylindole (DAPI) (Sigma) and mounted in antifading agent Citifluor AF1 (Citifluor Ltd.) ...
-
bioRxiv - Bioengineering 2020Quote: ... as-synthesized mesoporous silica nanoparticles (AMS-6) were loaded with 20% Dox (Doxorubicin hydrochloride, #D1515, Sigma-Aldrich). Dox diluted in 100% ethanol was added to AMS-6 nanoparticles in a round bottom flask mounted on a rotary evaporator ...
-
bioRxiv - Bioengineering 2020Quote: ... the glass fiber capture membrane was submerged for 6-8 hours in trifluoroacetic acid (TFA, Sigma-Aldrich), and dried at room temperature overnight before assembly ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6-7-week-old female mice were injected intraperitoneally with 1 mg of Tamoxifen (T5648, Sigma-Aldrich) on three consecutive days ...
-
bioRxiv - Bioengineering 2020Quote: ... FMN was added in excess (above its solubility limit) (F6750, Sigma-Aldrich: 70% pure, free RbF ≤ 6%) and samples were incubated on ice for at least 1 hour ...
-
bioRxiv - Microbiology 2019Quote: ... and zanamivir ((2R,3R,4S)-3-acetamido-4-(diaminomethylideneamino)-2-[(1R,2R)-1,2,3-trihydroxypropyl]-3,4-dihydro-2H-pyran-6-carboxylic acid) were purchased from Sigma, NN-DNJ from Toronto Biochemicals ...
-
bioRxiv - Pathology 2020Quote: ... We used primary mouse monoclonal antibodies against anti-α-acetylated tubulin (clone 6-11B-1, Sigma Aldrich and proliferating cell nuclear antigen (PCNA ...
-
bioRxiv - Microbiology 2021Quote: ... A549 (ATCC) or HeLa (ATCC) cells were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Trichloroethylene (CAS Number 79-01-6) and other chemicals were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise noted ...
-
bioRxiv - Neuroscience 2020Quote: ... Hamilton syringes with 33 gauge needles were used to deliver 2 µL of 6-OHDA (Sigma-Aldrich, France ...
-
bioRxiv - Neuroscience 2019Quote: Samples were incubated in a blocking solution of 10% DMSO/6% donkey serum (EMD Millipore, Temecula, CA)/0.2% Triton X-100/PBS at 37 °C for 2-3 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... They were then washed and permeabilized 6 x 5mins in PBSTx (PBS plus 0.5% Triton-X (Sigma)) and blocked for 2 hrs room temperature in PBSTx plus 5% goat serum (Sigma) ...
-
bioRxiv - Physiology 2019Quote: ... Nuclei were identified using 4′,6-diamidino-2-phenylindole (DAPI, 1□μg/ml, Sigma Aldrich, Dorset UK). SDH staining was performed as previously described (Smith et al. ...
-
bioRxiv - Immunology 2019Quote: ... then washed with 1% BSA/PBS and stained with 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich) for 10 min at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... vibratome sections (500 µm) from wild-type (C57BL/6) lungs were stained with rabbit anti-SftpC (Millipore) and Armenian hamster anti-Muc1 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... UFM1 (GCTGTGAAAGGTGTACTTTC) and UFC1 (GTGACAACGATTGGTTCCGAC) followed by selection with 75 µg/ml 6-thioguanine (Sigma-Aldrich, A4882) 4 days after electroporation ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell nuclei were stained with DAPI (1:1000, 4’ s-6-diamidino-2-phenylindole, Sigma Aldrich, USA) for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 6-day-old perithecia with TRI Reagent (Sigma-Aldrich, cat. no. T9424) and re-suspended in 5M urea ...
-
bioRxiv - Immunology 2020Quote: ... T cells were also stimulated for 6 hours with 50ng/ml PMA and 1μg/ml Ionomycin (Sigma). T cells were then harvested ...
-
bioRxiv - Molecular Biology 2021Quote: Melanoma cells treated with ARN22089 for 6 or 24 h and lysed in RIPA buffer (EMD Millipore or an optimized cocktail (250 mM NaCL ...
-
bioRxiv - Microbiology 2021Quote: ... approximately 3 to 6 L of diffuse flow fluid were pumped through 0.22 μm Sterivex filters (Millipore). Shipboard ...
-
bioRxiv - Developmental Biology 2021Quote: Adult fish (between 3-6 mpf) were anesthetized by immersion into 0.04% tricaine (Sigma, St Louis, MO) and the AF were carefully detached using surgical blade and forceps ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the embryos were treated for 6 days with 0.003% N-phenylthiourea (PTU) (Sigma, St Louis, MO) to inhibit pigment formation.
-
bioRxiv - Genetics 2020Quote: ... HUT 78 cells were treated up to 6 hours with 1 μM of romidepsin (Sigma-Aldrich, SML1175), DMSO being used as a control ...
-
bioRxiv - Genetics 2020Quote: ... cells were permeablised first with 1ml/well (6-well plate) mTESR1 medium with 8μg/ml polybrene (Millipore) for 15 min (37°C) ...
-
bioRxiv - Bioengineering 2020Quote: ... 20 g (±5 g) female C57BL/6 mice were injected intraperitoneally (I.P) with LPS (L-5886, Sigma). EVs were I.V injected via the tail vein subsequent to LPS induction and the animals were observed and weighed daily after induction ...
-
bioRxiv - Microbiology 2020Quote: ... 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2022Quote: ... and digested in 6 ml of 2-mg/mL type II collagenase (Sigma # C6885 or Worthington #LS004177) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.5 μg TRC2-pLKO-puro vector encoding shRNA (TRCN0000377256-NM_005871.3-637s21c1, designated here as shSMNDC1-6, or TRCN0000369078-NM_005871.3-724s21c1, designated here as shSMNDC1-7, Sigma) targeting different sequences of SMNDC1 ...