Labshake search
Citations for Millipore Sigma :
1751 - 1800 of 10000+ citations for 1 3 Bis 2 4 hydroxyphenyl 2 propyl benzene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 2% PenStrepNeo (Sigma), 0.02 mg/mL insulin (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% Hemicellulase (Sigma), 1% driselase (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2×SSC (Sigma), 10 % formamide (Calbiochem) ...
-
bioRxiv - Cell Biology 2020Quote: ... Prohibitin 2 (Sigma Rieske (Rabbit serum ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Sigma-Aldrich) plates supplemented with 5% defibrinated sheep’s blood at 37°C in a 5% CO2 atmosphere ...
-
bioRxiv - Neuroscience 2022Quote: ... CMTI-2 (Millipore), were electroporated using the Nucleofector II (Lonza) ...
-
bioRxiv - Neuroscience 2022Quote: ... 2% PFA (Sigma), 0.1M sodium cacodylate trihydrate ...
-
bioRxiv - Microbiology 2020Quote: ... the plates were emptied and a volume of 300 μl/well of blocking buffer (PBS-0.1% Tween (Sigma)-2% BSA (Sigma)) was added ...
-
bioRxiv - Microbiology 2020Quote: ... 2% nystatin (Sigma) and 0.1% penicillin-streptomycin (Gibco® ...
-
bioRxiv - Neuroscience 2021Quote: ... 2-mercaptoethanol (Sigma) and ESGRO leukemia inhibitory factor (LIF ...
-
bioRxiv - Cancer Biology 2020Quote: ... washed with PBS and blocked in blocking buffer (0.05% Tween (Sigma)/ 2% BSA (Sigma) in PBS ...
-
bioRxiv - Immunology 2020Quote: ... the plates were emptied and a volume of 300 μl/well of blocking buffer (PBS-0.1% Tween (Sigma)-2% BSA (Sigma)) was added ...
-
Myofiber injury induces capillary disruption and regeneration of disorganized microvascular networksbioRxiv - Physiology 2021Quote: ... 2 CaCl2 (Sigma), 1.17 MgSO4 (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... / 2% Acrylamide (Sigma) in PBS and incubated for 5 h at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... 2-mercaptoethanol (Sigma), insulin (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 2% NaN3 (Sigma) was dissolved in NB media ...
-
bioRxiv - Neuroscience 2020Quote: ... Lidocaine (2%) (Sigma) and CNQX disodium salt (100 μM ...
-
bioRxiv - Microbiology 2023Quote: ... 2’-bipyridyl (Sigma) to deplete residual iron ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% dextrose (Sigma). For experiments performed in the absence of inositol ...
-
bioRxiv - Neuroscience 2022Quote: ... Lidocaine (Sigma, 2%) was infused into the olfactory peduncle at the rate of 0.25 uL/min using a syringe pump ...
-
bioRxiv - Physiology 2022Quote: ... 2 CaCl2 (Sigma), 1.17 MgSO4 (Sigma) ...
-
bioRxiv - Physiology 2022Quote: Metric 2 (Sigma). The standard deviation of TGF oscillations ...
-
bioRxiv - Cell Biology 2022Quote: ... 2-deoxyglucose (Sigma/Merck ...
-
bioRxiv - Neuroscience 2024Quote: Formalin (2%, Sigma), PEG (30% ...
-
bioRxiv - Genomics 2023Quote: ... 2-mercaptoethanol (Sigma), LIF (Millipore) ...
-
bioRxiv - Immunology 2023Quote: ... + 2% Formaldehyde (Sigma)) pH 7.4 at RT for 2 h ...
-
bioRxiv - Neuroscience 2023Quote: ... pentraxin-2) (Millipore HCVD3MAG-67K Luminex magnetic bead panel) ...
-
bioRxiv - Molecular Biology 2022Quote: ... / 2% Ammonia (Sigma). After vacuum centrifugation ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% PenStrepNeo (Sigma), 0.02 mg/mL insulin (Sigma) ...
-
bioRxiv - Pathology 2024Quote: ... (2) from Millipore-Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... 2’-bipyridyl (Sigma) to deplete residual iron ...
-
bioRxiv - Pathology 2024Quote: ... (2) from Millipore-Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... 2% DABCO (Sigma). Imaging was performed on an LSM 980 Confocal Microscope with a 63X Plan Apochromat N.A ...
-
bioRxiv - Neuroscience 2024Quote: ... biocytin (Sigma; 2%) was added to evaluate morphology ...
-
bioRxiv - Cell Biology 2022Quote: ... MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) was used for cell viability (Sigma, Israel).
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was evaluated by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma) assay as described previously(Lv et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were next incubated with 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Sigma-Aldrich M5655) for 4h followed by formazan crystal solubilization with isopropanol and absorbance readings at OD570 (Kumar et al. ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cytotoxicity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) assays ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was evaluated by adding MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Sigma) to the cells for 4 h and OD562 measurements according to the manufacturer’s protocols (Sigma).
-
bioRxiv - Bioengineering 2020Quote: ... and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) were purchased from Sigma-Aldrich. Glutaraldehyde (50% w/w ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10 mM Sodium butyrate supplemented with 25 μl Phosphatase Inhibitor Cocktail 2&3 (P5726&P0044, Sigma) and 1 tablet of proteinase inhibitor cocktail (A32963 ...
-
bioRxiv - Microbiology 2020Quote: ... phenylethanol and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) were obtained from Sigma-Aldrich.
-
bioRxiv - Molecular Biology 2023Quote: ... coverslips were incubated for 3 hours in 100 μl of 2% acrylamide (AA; A4058, Sigma-Aldrich) + 1.4% formaldehyde (FA ...
-
bioRxiv - Microbiology 2023Quote: ... and tissues digested in 3 mL complete HBSS-2 containing 0.5 mg/mL Collagenase-D (Sigma) at 37°C for 30 minutes ...