Labshake search
Citations for Millipore Sigma :
1701 - 1750 of 10000+ citations for DHEA S ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... or IgG2a-HRP conjugated (Southern Biotechnology Associates) and TMB liquid substrate system for ELISA (Sigma-Aldrich, St. Louis, MO). The plates were read in an ELISA plate reader at 405 nM (IgE ...
-
bioRxiv - Neuroscience 2022Quote: To inject a dopamine transporter (DAT) inhibitor (GBR12909, D052, Sigma Aldrich, MO, 5 mg/ml in distilled water with 5% dimethyl sulfoxide, 67-68-5, Sigma Aldrich, MO) or vehicle (distilled water with 5% dimethyl sulfoxide) ...
-
bioRxiv - Pathology 2023Quote: ... The solvent (n=5) or an FXIa inhibitor (ONO-1600586, 3 µmol/L n=5) and mepacrine (Sigma-Aldrich; final concentration 5 µM) were added to the blood before perfusion ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Vinculin (Vin-11-5) (1:5000; Sigma-Aldrich, SAB4200729, Vin-11-5), mouse anti-α-tubulin (B-5-1-2 ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL-1 and 5×10-7 M hydrocortisone hemisuccinate (Sigma). Cells were seeded and expanded for two weeks and subsequently differentiated for another two weeks in the presence of 1.8% DMSO61 (dHepaRG).
-
bioRxiv - Microbiology 2020Quote: ... 5 μg human insulin mL−1 and 5×10−7 M hydrocortisone hemisuccinate (Sigma). As a control we generated HepaRG cells expressing an inactive HBx null mutant (HepaRG-HBxSTOP ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 ng/μL NGF and 40 μM 5-UfDU (uridine and 5-fluorodeoxyuridine, Sigma). Cultures were maintained at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... then treated with 1 uM of 5-Aza-2-deoxycytidine (5 –Aza, SIGMA, A3656) or PBS for 4 days ...
-
bioRxiv - Genetics 2022Quote: ... was diluted in molecular biology-grade water and 5-fluorouracil (5-FU) (Sigma-Aldrich) diluted in dimethyl sulfoxide (SigmaAldrich) ...
-
bioRxiv - Immunology 2022Quote: ... 5% CO2.with a mixture of 5 μg/mL polybrene (Sigma TR-1003-G) and pseudovirus diluted to a titer that produces 1*108 total integrated intensity units/mL ...
-
bioRxiv - Microbiology 2021Quote: ... media was supplemented with 50 mg L−1 5-aminolevulinic acid (5-ala, Sigma). When appropriate ...
-
bioRxiv - Microbiology 2021Quote: ... Top2β: Forward primer 5’CAGCCCGAAAGACCTAAATAC and reverse primer 5’ATCTAACCCATCTGAAGGAAC obtained from Sigma-Aldrich.
-
bioRxiv - Microbiology 2021Quote: ... and 5 g glucose) with 5 μl Penicillin-Streptomycin Stabilized solution (Sigma-Aldrich, P4458) and 24 μl of Amphotericin B solution (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of 5 mM Nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD, Sigma cat # N2630) solution were added to each well immediately prior to the beginning of measurements and mixed by pipetting to reach a concentration of 500 μM in the 50 μl final volume reaction ...
-
bioRxiv - Cancer Biology 2022Quote: ... fish were incubated for 5 min with 5 mg.ml-1 adrenaline (epinephrine, Sigma, E4642) in order to contract the pigment in melanocytes prior mounting in LMP for imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... the following 5-HTR antagonists were used: WAY100635 (W108, Sigma-Aldrich; for 5-HT1AR), GR55562 (cat# 1054 ...
-
bioRxiv - Bioengineering 2023Quote: ... 5-Aminolevulinic acid hydrochloride >98% (5-ALA) (Sigma Aldrich, St. Louis, Missouri, United States) was used for cell dosing alongside standard GBM media ...
-
bioRxiv - Biochemistry 2023Quote: ... Disodium salts of nucleoside-5’-monophosphates (5’-NMPdss) were purchased from Sigma-Aldrich (Bangalore). All other reagents were purchased from Sigma-Aldrich and were of alalytical grade.
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM 2-amino-5-phosphonopentanoic acid and 100 U/ml DNase (DN25, Sigma) for 25 min ...
-
bioRxiv - Microbiology 2023Quote: ... low = 5 X 105 parasites) or concanamycin A (CON A) (5 μg/ml, Sigma); supernatants were harvested at 72 h ...
-
bioRxiv - Immunology 2023Quote: ... 5 ml of PBS and 5 ml of 4% Dextran (Sigma-Aldrich, 31392-50G) in PBS (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 μM diphenyleneiodonium chloride (DPI) (Millipore-Sigma, D2926, resuspended to 5 mM in DMSO) in Hanks Balanced Salt Solution (HBSS ...
-
bioRxiv - Cancer Biology 2023Quote: ... for 5 min and blocked in 5% FBS (Sigma Aldrich, cat. no. F7524-500ml), 0.1% Triton™ X-100 ...
-
Nucleolar Pol II interactome reveals TBPL1, PAF1, and Pol I at intergenic rDNA drive rRNA biogenesisbioRxiv - Molecular Biology 2023Quote: ... the cells were exposed to 1 mM 5-fluorouracil (5-FU; Sigma, Cat# F5130) for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following concentration ranges were tested: 100–0.1 µM for 5-fluorouracil (5-FU, Sigma), alpelisib (Biozol ...
-
bioRxiv - Cell Biology 2024Quote: ... or pre-treated for 5 min and then incubated with 5 mM succinate (Sigma), or both in combination ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5 mM nicotinamide 1,N6-ethenoadenine dinucleotide (εNAD+, Sigma cat# N2630) was added to each well immediately before measurements ...
-
bioRxiv - Microbiology 2019Quote: ... 135 µL of culture was distributed in a 96-well plate (Cellstar, 96 Well Cell Culture Plate, U-bottom) and 15µL of H2O or Mitomycin C (Sigma)) was added at the appropriate dilution ...
-
bioRxiv - Synthetic Biology 2021Quote: ... media in each well was replaced with 100µL (for 96-well plate format) or 200µL (for 48-well plate format) complete DMEM in addition to 2µM ionomycin (Sigma-Aldrich) and 5mM CaCl2 with or without 10µM furimazine (unless indicated otherwise) ...
-
bioRxiv - Neuroscience 2022Quote: ... and seeded at a density of 2 × 106 cells per well (6-well plates) or 0.5 × 106 cells per well (24-well plates) into PDL/Laminin (Sigma)-coated plates with neuronal medium plus 0.5 μM RA ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected CAD5 cells were seeded in ELISPOT plates (multiscreen 96-well filter plates with high protein-binding Immobilon-P membrane, 0.45 µm, Millipore) activated with 70% ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... Dilutions were plated on TY plate and in TY plate containing either 750 µM of DEA NONOate (Sigma-Aldrich), 0.1% of NaClO (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg/mL Insulin (Sigma), 10 ng/mL EGF (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM ATP (A2383, Sigma), 1 mM tris(2-carboxyethyl)phosphine (TCEP ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5% Kolliphor HS-15 (Sigma) and 90% saline and delivered by intraperitoneal injection daily ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 mM pyruvate (Sigma-Aldrich) and 0.56 μL ml-1 NaOH (1M) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 mM Trolox (Sigma-Aldrich), and 10 mM sodium azide (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 5% horse serum (Sigma), EGF (20ng/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% formamide (Sigma-Aldrich #F9037), 0.5x SSC (75 mM NaCl ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml insulin (Sigma), 50 μg/ml gentamicin (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% BSA (A4503, Sigma) for one hour at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 ng/mL EGF (Sigma), 3 ng/mL mFGF2 (R&D Systems) ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/ml insulin (Sigma) and 0.05 mM β-mercaptoethanol (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/mL kanamycin (Sigma) and 250 ng/mL amphotericin B (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1mM 5-Ethynyluridine (Sigma Aldrich) was added to the culture medium and the plate was incubated for 2 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μM sunitinib malate (Sigma), or 5 μM ISCK03 (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... or 5 μM ISCK03 (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μM imatinib mesylate (Sigma), 5 μM sunitinib malate (Sigma) ...
-
Differential polysaccharide utilization is the basis for a nanohaloarchaeon : haloarchaeon symbiosisbioRxiv - Microbiology 2019Quote: ... 5 mM TCEP (Sigma-Aldrich) and a protease inhibitor cocktail (Sigma-Aldrich) ...