Labshake search
Citations for Millipore Sigma :
1701 - 1750 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... 1% phosphatase inhibitor cocktail 3 (Sigma-Aldrich, St. Louis, MO), 10 mM N-ethylmaleimide (NEM) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX; Sigma, No.I5879) (DCI) ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by cysteine blocking for 10 minutes at room temperature using methyl methanethiosulfonate (MMTS, Sigma) at a final concentration of 10mM ...
-
bioRxiv - Developmental Biology 2021Quote: ... Thawed sperm was preincubated for 30 minutes in TYH (with Methyl-b-cyclodextrin, Sigma C4555) medium at 37 deg C ...
-
bioRxiv - Cell Biology 2019Quote: ... Methyl-β-cyclodextrin (product C4555) and cholesterol oxidase (product C8649) were purchased from Sigma-Aldrich.
-
bioRxiv - Microbiology 2020Quote: ... washed with tap water and stained with methyl crystal violet solution (0.2% v/v) (Sigma).
-
bioRxiv - Bioengineering 2021Quote: ... Aggregatibacter actinomycetemocomitans strain 29522 (ATCC) resuspended in 2% low viscosity carboxy-methyl-cellulose (Sigma-Aldrich). Oral lavage was repeated every week for 5 weeks ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 g of (0.42 mmol) N-α-acetyl-L-lysine methyl ester HCl (Sigma Aldrich) and 10 mL of ultrapure water ...
-
bioRxiv - Neuroscience 2020Quote: ... zebrafish larvae were anaesthetised in PBS containing 0.02 % aminobenzoic-acid-ethyl methyl-ester (MS222, Sigma), as described (Tsarouchas et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Mannose inhibition: biotinylated HHL was incubated with methyl mannose (200 mM; 30 min, RT; Sigma) prior to HHL staining.
-
bioRxiv - Cancer Biology 2021Quote: L-leucyl-L-leucine methyl ester (L7393) and Bafilomycin A1 (B1793) were purchased from Sigma and used at 1mM concentration and 100nM respectively ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed 1x in PBS followed by treatment with 10mM methyl-ß cyclodextrin (Sigma), 1mM water-soluble cholesterol (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... The retention time was locked using standard mixture of fatty acid methyl esters (Sigma Aldrich).
-
bioRxiv - Bioengineering 2022Quote: ... The lipase from porcine pancreas and methyl cellulose (viscosity 25 cp) were obtained from Sigma Chemical Co ...
-
bioRxiv - Cancer Biology 2022Quote: ... GCN2iB used for animal studies was formulated in 0.5% Methyl Cellulose (Sigma-Aldrich, Cat. #M0262) containing 5% DMSO ...
-
bioRxiv - Biophysics 2019Quote: Methyl beta-cyclodextrin (mβCD) and Latrunculin A (Lat A) were obtained from Sigma-Aldrich (Singapore), and were solubilized in phosphate-buffered saline (PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... high-performance liquid chromatography (HPLC)-grade tert-butyl methyl ether (t-BME, Sigma-Aldrich, #34875), HPLC-grade acetonitrile (FUJIFILM Wako ...
-
bioRxiv - Plant Biology 2019Quote: ... and GUS activity was expressed as pmol of 4- methyl-umbelliferone (4-MU, Sigma, USA) per µg protein per min ...
-
bioRxiv - Neuroscience 2021Quote: ... was dissolved in vehicle solution containing 98% methyl cellulose Tylose (Sigma Aldrich, Zwijndrecht, the Netherlands) and 2% Tween80 (Sigma Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... Peaks were identified using a bacterial fatty acid methyl esters (BAME) mix (Sigma Aldrich, UK) and quantified using a 37-component fatty acid methyl esters (FAME ...
-
bioRxiv - Microbiology 2021Quote: ... and quantified using a 37-component fatty acid methyl esters (FAME) mix (Sigma Aldrich, UK). The biomass of each group of microorganisms was determined using the combined mass of fatty acids to which the group is attributed in Table S2.
-
bioRxiv - Developmental Biology 2022Quote: ... followed by derivatization with 70μl of N-tert-Butyldimethylsilyl-N- methyl-trifluoroacetamide (Sigma-Aldrich, 394882) for 1 hour at 70 °C ...
-
bioRxiv - Neuroscience 2022Quote: ... we have placed the dissected muscle directly into isopentane (2-methyl butane, Sigma Aldrich, USA) pre-cooled in liquid nitrogen until processed for sectioning ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice were injected with the muscarinic antagonist scopolamine methyl nitrate (1mg/kg s.c., Sigma Aldrich) to reduce the peripheral effects of PILO ...
-
bioRxiv - Cell Biology 2022Quote: Solvents for lipid extraction were tert-butyl methyl ether (HPLC grade, Sigma-Aldrich, 34875-1L) and methanol (HPLC grade ...
-
bioRxiv - Microbiology 2023Quote: ... phosphate-citrate buffer with sodium perborate and Methyl-α-D mannose were purchased from Sigma. Lentil lectin resin ...
-
bioRxiv - Cell Biology 2023Quote: We determined exopher sensitivity of animals to acute oxidative stress using paraquat (methyl viologen, Sigma). We transferred L4 animals to freshly prepared NGM plates containing paraquat 200 mM and assessed percent survival after an overnight exposure.
-
bioRxiv - Physiology 2023Quote: ... the femurs were immersed in infiltration solution made of 85% destabilized methyl methacrylate (MMA, Sigma), 15% dibutyl phthalate (Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... the substrate-free solution was supplemented with N- methyl-D-glucamine (NMDG) hydrochloride (Sigma-Aldrich) at the same concentration to avoid interference with the Ag/AgCl reference electrode ...
-
bioRxiv - Neuroscience 2023Quote: ... roughly 150 nL of 2% N-methyl-DL-aspartic acid (NMDA; Sigma, St Louis, MO) was injected bilaterally into the LHb using a Picospritzer II and ejection micropipette ...
-
bioRxiv - Microbiology 2023Quote: ... (v) methyl viologen (MV) solutions: MV solutions were prepared by diluting MV (Sigma, 10 mM) directly into the media of choice.
-
bioRxiv - Neuroscience 2024Quote: ... Lipids were extracted with 600 µl ice-cold methyl tert-butyl ether (MTBE, Sigma-Aldrich) and 150 µl methanol (VWR) ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse monoclonal anti-Na+/K+ ATPase (1:500; SantaCruz) and anti-acetylated tubulin (1:2,000; clone 6-11B-1, Sigma Aldrich). Goat anti-mouse or rabbit IgG conjugated with HRP were used for secondary antibodies (1:10,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... centrifuged and the cell pellet was lysed using a Lysis Buffer (25 mM Tris pH 7.6, 150 mM NaCl, 1% NP-40, 1% Na-deoxycholate, and 0/1% SDS in water + protease inhibitor cocktail [Sigma] + phosphatase inhibitor cocktail [Sigma-Aldrich] + okadaic acid + sodium fluoride) ...
-
bioRxiv - Microbiology 2020Quote: ... samples were incubated with 3% acetic acid for 5 min and followed by Alcian blue (Sigma, B8438) (in 3% acetic acid ...
-
bioRxiv - Microbiology 2019Quote: ... MH agar was supplemented with 100 μg/mL XS (5-bromo-4-chloro-3-indolylsulfate (Sigma-Aldrich)) with or without 0.35 μg/mL anhydrotetracycline (ATc ...
-
bioRxiv - Physiology 2019Quote: ... A loophole from the bacterium was suspended in 5 mL of 3% tryptic soy broth (Fluka, Sigma) and incubated at 37ºC for 24 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... per sample were washed 3 times with PBS/BSA (PBS with 5 mg/ml BSA (Sigma Aldrich)) ...
-
bioRxiv - Cell Biology 2019Quote: ... Coverslips were washed 3 times for 5 min then incubated with secondary antibodies and Hoechst 33258 (Sigma) for 1 hour at room temperature and again washed ...
-
bioRxiv - Immunology 2019Quote: ... splenocytes were cultured alone in T cell media supplemented with 3-5 μg/ml ConA (Sigma Aldrich) or together with collagen matrices of 1 mg/ml or 4 mg/ml collagen without any embedded RAW 264.7 macrophages ...
-
bioRxiv - Biochemistry 2021Quote: ... Adenosine 3′-phosphate 5′-phosphosulfate lithium salt hydrate (PAPS) and the antibiotics were purchased from Sigma-Aldrich Co ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2023Quote: ... washed with PBST (0.1% Triton X-100 in 1X PBS; 3 x 5 minutes; Sigma-Aldrich, X100), and incubated with Click-iT Plus EdU reaction cocktail (Alexa Fluor 555 ...
-
bioRxiv - Physiology 2022Quote: ... we tested for leak of FITC-dextran (FD4; 3–5 kDa, Sigma-Aldrich, St Louis, MO, USA) from isolated gut segments of L ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of 4 mM 5-bromo-4-chloro-3-indolyl α-D-N-acetylneuraminic acid (Sigma) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... 3-dione (CNQX) and 50 mM D,L-2-amino-5-phosphonovaleric acid (APV) acquired from Sigma to suppress post-synaptic responses ...
-
bioRxiv - Microbiology 2023Quote: ... the reverse primer CCR5del2 (5’-CATGATGGTGAAGATAAGCCTCACA-3’) was common for both (all Sigma-Aldrich; St. Louis, MO). Two PCR master mixes differing only in the forward primer were prepared at a final volume of 10 µL ...
-
bioRxiv - Cell Biology 2023Quote: ... human Ndc80/Hec1 siRNA (sequence antisense: 5’-GAAUUGCAGCAGACUAUUA-3’, dTdT overhangs, Sigma-Aldrich, St. Louis, MO, USA), human KIF4A siRNA (sc-60888 ...