Labshake search
Citations for Millipore Sigma :
1551 - 1600 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and 1 million NALM-6 cells with PKH26 red fluorescent dye (Sigma) as per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... The fish were treated for 6 hours with 1 mM BrdU (Sigma) in water with 0.3% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Genetics 2023Quote: ... rabbi-anti-Zwf1 (Glucose-6- phosphate dehydrogenase; Sigma A9521; at 1:10,000) overnight at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... GR (final concentration of 6 µg ml-1, Saccharomyces cerevisiae, Sigma-Aldrich CAS 9001-48-3 ...
-
bioRxiv - Biophysics 2023Quote: ... and 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox) (Sigma). See Supplementary Table 1 for the full list of docking and imager strands.
-
bioRxiv - Molecular Biology 2024Quote: ... and Trolox (6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; 1 mM; Sigma). The biotinylated ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primary antibodies for cilia (mouse anti-acetylated tubulin, 1:1000 dilution, Sigma, cat# 6-11B-1) were diluted in block buffer and incubated on slides for 2hr at RT or overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... and mouse anti-acetylated α-tubulin (clone 6-11B-1, Millipore-446 Sigma, #MABT868, 1:500) were diluted in 5% normal goat serum (NGS ...
-
bioRxiv - Developmental Biology 2022Quote: ... and mouse anti-acetylated α-tubulin (clone 6-11B-1, Millipore-446 Sigma, #MABT868, 1:500) were diluted in 5% normal goat serum (NGS ...
-
bioRxiv - Cell Biology 2021Quote: ... Embryos were incubated with acetylated tubulin antibody (clone 6-11B-1, MABT868, Sigma-Aldrich, 1:1000) overnight at 4 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... Acetylated tubulin mouse monoclonal 6-11B-1 (1:1000 for IF & WB) (Sigma-Aldrich Cat# T7451); Pericentrin rabbit polyclonal Poly19237 (1:500 for IF ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primary antibodies used were: mouse anti α-tubulin 1:1000 (T6199, clone 6-11B-1, Sigma), mouse anti acetylated-α-tubulin FITC conjugated 1:250 (sc23950 ...
-
bioRxiv - Biochemistry 2023Quote: 2-Pyridinecarboxaldehyde (1) and 6-(1-piperazinylmethyl)-2-pyridinecarboxaldehyde bistosylate salt were purchased from Sigma-Aldrich. 5-Ethynylpicolinaldehyde (“alkyne-2PCA” ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 mins in phosphate-buffered saline (PBS) with 0.1% Tween-20 (both Sigma-Aldrich) and probed for 1 hour at room temperature in the dark with IRDye® 800CW conjugated goat anti-mouse secondary antibodies (LiCOR Biosciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... shLmnA (produced in our lab), shLMNC (produced in our lab, 5′-TCTCCCACCTCCATGCCAAAG-3’) or shLMNB1 (Sigma clone NM_010721.1-956s1c1 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed and developed with chromogenic 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, Sigma-Aldrich, B6149).
-
bioRxiv - Physiology 2020Quote: ... and T3 (3,3’,5-triiodo-L-thyronine, > 95% HPCL, CAS number 6893-02-3, Sigma-Aldrich) were first dissolved in 0.1M NaOH and then diluted in 0.9% NaCl ...
-
bioRxiv - Physiology 2019Quote: ... and T3 (3,3’,5-triiodo-L-thyronine, >95% HPCL, CAS number 6893-02-3, Sigma-Aldrich), first dissolved in 0.1M NaOH and then diluted in 0.9% NaCl ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-5 μL of biliverdin hydrochloride (chromophore for iRFP signal activation, final concentration 0.002%, Sigma; 30891) added to cells and incubated for 10 mins at 37 °C before imaging ...
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Argentina).
-
bioRxiv - Bioengineering 2022Quote: ... Sections were washed 3×5 minutes in TBST buffer and incubated with ChAT antibody (Sigma, AB144) at 1:100 dilutions overnight at 4°C in the blocking buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were allowed to differentiate for 5 days with differentiating media [3 μg/ml prolactin (Sigma, #L6520 ...
-
bioRxiv - Cell Biology 2022Quote: ... The reagents treated for some indicated experiments include: 3-5 µM oligomycin A (Sigma, Cat# 75351), 1 µM (for HeLa cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 μM of the PKA activator 8-Bromoadenosine 3’,5’-cyclic monophosphate (Sigma, dissolved in water) and without FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed with PBS 3 times and blocked with 5% normal donkey serum (Sigma-Aldrich) in wash buffer for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... The purified protein 5-HT2C or HCA2 (3 μg) was immobilized on nickel agarose beads (Sigma) in the incubation buffer containing 50 mM HEPES ...
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...
-
bioRxiv - Neuroscience 2020Quote: ... and guanosine-5’-γ-3-thiotriphosphate (GTPγS) were acquired from Sigma-Aldrich (St. Louis, MO, USA). WIN 55,212-2 was purchased from Tocris Bioscience (Bristol ...
-
bioRxiv - Cell Biology 2019Quote: ... shRNA specific for hERG1b 5’-CCACAACCACCCTGGCTTCAT-3’ and its respective control were purchased from Sigma-Aldrich. For heterologous expression ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2022Quote: ... and Mannitol (3 g of Bacto Peptone [Becton Dickinson], 5 g of Yeast Extract [Sigma-Aldrich] ...
-
bioRxiv - Bioengineering 2023Quote: ... All reaction mixtures contained 250 nM of sirtuin (SIRT1-3, 5 Reaction Biology, SIRT4,6,7 Sigma-Aldrich), 10 µM furimazine (Promega) ...
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Cell Biology 2023Quote: ... human Spindly siRNA (Sequence antisense: 5’-GAAAGGGUCUCAAACUGAA-3’, dTdT overhangs, Sigma-Aldrich, St. Louis, MO, USA), and control siRNA (D-001810-10-05 ...
-
bioRxiv - Microbiology 2024Quote: ... 3-(2pyridyl)-5,6-bis(2-(5-furylsulfonic acid))-1,2,4-triazin (Sigma-Aldrich, St Louis, MO, USA) (27) ...
-
bioRxiv - Systems Biology 2024Quote: ... 8-Br cAMP (8-Bromoadenosine 3′,5′-cyclic monophosphate, final conc. 500 µM; Sigma B6386-100mg). In addition to stimulation for decidualization ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Cell Biology 2024Quote: ... The proteins were eluted in buffer 5 [buffer 3 plus 200 μM FLAG peptide (Sigma-Aldrich)] for 1.25 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Parasites were maintained at <3% parasitemia and routinely synchronized by treating with 5% sorbitol solution (Sigma) for ring stage and by using percoll gradient (Cytiva ...
-
bioRxiv - Microbiology 2021Quote: ... and blocked during 1 h with 3 % BSA (Probumin) or 1% gelatin (Sigma) in PBS ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The plates were incubated for two hours at RT and 2,2′-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) substrate solution (Sigma-Aldrich, USA) was added for colour development ...
-
bioRxiv - Neuroscience 2021Quote: ... Each well of 6-well cell culture treated plates coated with 0.1% Poly-L-ornithine (3 ug/mL; Sigma Aldrich, P4957) were seeded with ∼750K cells and maintained with sterile-filtered neurobasal medium (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... BI-D1870 (called ‘p90RSKi’ in this study, Cayman 15264), BIO-6-bromoindirubin-3′-oxime, aka BIO (called ‘GSK3i2’ in this study, (Sigma B1686), BI 2536 (called ‘PLKi’ in this study ...
-
bioRxiv - Bioengineering 2020Quote: ... nalidixic acid (NA; N8878, BCBW6556), and 4′,6-diamidino-2-phenylindole (DAPI; D9542, 28718-90-3) were purchased from Sigma Aldrich, USA ...
-
bioRxiv - Microbiology 2020Quote: ... Transverse sections (6 µm) were sectioned and mounted on silane-covered (TESPA, 3-aminopropyl-triethoxysilane, Sigma-Aldrich, St. Louis, Missouri, USA) glass slides ...
-
bioRxiv - Microbiology 2019Quote: The Nafion films on the IDAs mounted in the Teflon cell were loaded with various amounts of Ru(NH3)6 3+ by either exposing the films to a 10 mM solution of Ru(NH3)6Cl3 (Sigma Aldrich) in 0.2M Na2SO4 at time points from several minutes to several hours or by allowing Ru(NH3)6 3+ in the films to diffuse out into bulk electrolyte for several hours ...
-
bioRxiv - Cell Biology 2022Quote: The neuroprotective effect of CA against 6-OHDA was evaluated by MTT reagent (3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide) (Sigma Aldrich, UK, M5655) according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2020Quote: ... transfected in the Lonza 4D nucleofector program ‘CA-137’and seeded onto a Matrigel-covered 6-well plate in 3 ml StemFlex containing 10 μM Thiazovivin (Millipore, #S1459). The cells were subjected to a 48 hour cold shock at 32 °C to enhance homology directed repair (HDR) ...