Labshake search
Citations for Millipore Sigma :
1651 - 1700 of 10000+ citations for Glioma pathogenesis related protein 1 GliPR1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Target sequences (CTTCAACGTCTCTCAACAGAT #1 and CCGAGTTCTATGAGAACGACT#2) against human CD19 and a control scrambled sequence (CTCAATCAACAGATCTCGTCT) were inserted into the pLKO.1 vector (Sigma).
-
bioRxiv - Cancer Biology 2020Quote: RH30 and RH41 cells were transfected with 100nM of human DDX5 specific siRNA (siDDX5 #1 and siDDX5 #2, Sigma-Aldrich) or scrambled control siRNA (siCTR ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were washed then sequentially incubated with anti-SARS-CoV-2 CR3022 antibody (Yuan et al., 2020) (1 μg/mL) and a HRP-conjugated goat anti-human IgG (Sigma) in PBS supplemented with 0.1% (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... plates were washed 4 times with PBST and further incubated with 100 μL per well of goat anti-human IgG (Fc specific)-Peroxidase antibody (1: 5000 dilution, Sigma) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated 30 seconds in plasma cleaner then coated with cell-specific adhesive surface: for at least 1 hour with 10 μg/ml recombinant human fibronectin (Sigma) for Hela and SHSy-5Y cells ...
-
bioRxiv - Microbiology 2020Quote: rAkata EBV-infected cells was reactivated at 1×106 cells/mL with a goat polyclonal anti-human IgG Fc-specific antibody (Sigma) for 48 hours ...
-
bioRxiv - Immunology 2022Quote: ... Stable knockdown of human LRBA was generated by lentiviral transfection with the short hairpin (sh) RNA expressing vector pLKO.1 (SIGMA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... The infectious blood meal consisted of a 2:1 mix of washed human erythrocytes and viral suspension supplemented with 10 mM ATP (Sigma). The infectious titers were 107 FFU/mL for DENV-1 ...
-
bioRxiv - Neuroscience 2022Quote: ... To assess the NOTCH3 ECD deposits the tissues were incubated overnight at 4 °C with mouse monoclonal anti-human NOTCH3 ECD primary antibody (1:100, clone 1E4, Millipore) followed by detection with Alexa 594 conjugated anti-mouse secondary antibody (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... Alkaline phosphatase (AP)-labeled goat anti-human IgM (μ-chain specific; Sigma-Aldrich, Vienna, Austria; 1:50,000 in TBS BSA), AP-labeled goat anti-human IgG (γ-chain specific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Exponentially growing RPE-1 (human retinal pigment epithelial) cells were pulse-labeled with CldU (5-Chloro-2’-deoxyuridine, Millipore Sigma) and IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Genetics 2023Quote: ... Then cells were resuspended in the BD-FACS staining buffer and labelled through anti-human TRA-1-60 antibody (Millipore) and anti-mouse IgM control ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibod-ies were used for western blots of human cell extracts: Mouse anti-FLAG (Sigma F1804, 1:1000); Mouse anti-GAPDH (Proteintech 60004-1-Ig ...
-
bioRxiv - Molecular Biology 2023Quote: ... The process was the same as in fibroblasts and the primary antibodies were anti-human NANOG (1:100, Millipore #AB5731) and SSEA4 (1:25 ...
-
bioRxiv - Bioengineering 2023Quote: ... encoding the human KRASG12V and KRASY64A mutants (residues 1–169) and human SOS1 (residues 564–1049) were cloned as NdeI and XhoI fragments into pET28b (Novagen). His-tagged KRAS•GDP (abbreviated RAS ...
-
bioRxiv - Cell Biology 2022Quote: ... and Mirg-/-littermates injected subcutaneously with Growth factor-reduced Matrigel BD) with 400 ng mL-1 recombinant human bFGF (Millipore). After 7 days Matrigel plugs ...
-
bioRxiv - Immunology 2023Quote: ... in FACS-blocking buffer (mixture of 0.66% human/rabbit/mouse serum, Sigma-Aldrich, and 1% Bovine Serum Albumin, Sigma-Aldrich) for 40 minutes at 4 °C ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... Immunofluorescence in human cells was conducted as previously described using antibodies against tubulin (1:1000 anti-beta tubulin, mouse, T7816, Sigma OR 1:2000/1:1000 anti-alpha tubulin ...
-
bioRxiv - Immunology 2023Quote: ... The wells were washed with PBS-0.1% Tween 20 and then incubated with 100 μl of 100 μg/well of biotinylated rabbit anti-human C1q (Sigma) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... The antibodies used in this study were: polyclonal rabbit anti-human HINT1 antibody (1:1000, Sigma, San Luis, MO, USA), and to demonstrate equal loading mouse monoclonal anti-β-actin antibody (1:5000 ...
-
bioRxiv - Bioengineering 2023Quote: ... substrates containing 400 nm diameter pores at a density of 2·106 pores·cm-2 were coated with 100 µL of 1 µg/mL human plasma fibronectin (Sigma-Aldrich) in PBS (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... Polyacrylamide gels were then immediatly coupled to either human plasma fibronectin (1 mg/mL overnight at 37◦C; FC010, Millipore) or ICAM-1 (0.1 mg/mL Recombinant Protein A (Novex ...
-
bioRxiv - Neuroscience 2024Quote: ... the plate was washed 5 times with PBS and incubated for 1 hour with goat anti-human IgG (Fc specific) –peroxidase (#A0170, Sigma). Binding signals were developed and stopped by the addition of TMB (3,3’,5,5’-tetramethylbenzidine ...
-
bioRxiv - Microbiology 2024Quote: ... 10 ng recombinant IdeS was pre-incubated with sera dilutions as indicated at 37°C 1 h before addition of 100 ng human IgG (Sigma) in assay diluent (AD ...
-
bioRxiv - Bioengineering 2020Quote: ... Negatively selected human monocytes (Astarte Biologics) were suspended in RPMI 1640 supplemented with 2% human AB serum (Sigma-Aldrich), 1% GlutaMax (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293 (human embryonic kidney) and U2OS (human bone osteosarcoma) cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Sigma-Aldrich) supplemented with 10 % FBS ...
-
bioRxiv - Bioengineering 2023Quote: ... Detection of IgG1 employed anti-human IgG (VH+VL) (Jackson) and of IgA2 anti-human IgA (Hc only) (Sigma). Commercial antibodies were used at dilutions recommended by manufacturer ...
-
bioRxiv - Biochemistry 2024Quote: Human embryonic kidney cells (HEK293T) and human fibroblast cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Sigma Aldrich), supplemented with fetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2022Quote: ... Protein G (Sigma) was coupled at 10 µg/mL in the presence of 10 mM sodium acetate buffer pH 4.5 at 30 µL/min for 300 seconds until ∼3500-4000 RU was immobilized ...
-
bioRxiv - Microbiology 2021Quote: ... Protein G (Sigma) was covalently coupled following activation ...
-
bioRxiv - Biophysics 2020Quote: ... Protein G (Sigma) at 10 μg/mL was coupled in the presence of 10mM sodium acetate buffer pH 4.5 at 30 μl/min for 300 seconds in various channels ...
-
bioRxiv - Bioengineering 2021Quote: ... in PBS at 37°C for 30 minutes and subsequently incubated for two hours with a 1:200 concentration anti-glial fibrillary acidic protein (GFAP) antibody produced in mouse (Sigma, 1:200) and 1:500 concentration anti-β-Tubulin III antibody produced in rabbit (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... and Zbtb16 (1:250, Santa-Cruz, Mississauga, ON) Beta-actin was used as a reference protein (1:5000, Sigma-Aldrich, Oakville, ON). Blots were scanned by Amersham Imager 600 imaging system (GE Healthcare ...
-
bioRxiv - Molecular Biology 2022Quote: ... rinsed with PBS and the proteins were visualized with Immobilon Western Chemiluminiscent HRP substrate (Merck/Millipore, used at 1:1:3 (H2O) dilution ...
-
bioRxiv - Pathology 2020Quote: ... Proteins were immunoblotted with antibodies against FECH (rabbit, 1:400, LS Bio, #LSC409953, and β-actin (mouse, 1:5000, Sigma-Aldrich, AC40). Secondary antibodies ...
-
bioRxiv - Microbiology 2021Quote: ... coverslips were labeled with antibodies as follows: HA-tagged proteins were detected with rat anti-HA 3F10 (Sigma 1:200-1:500), parasitophorous vacuole with in-house mouse anti-MAG1 (1:500) ...
-
bioRxiv - Physiology 2021Quote: ... For colocalization 1:100 anti-NBCe1 was incubated with 1:1,000 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07-623) or 1:200 anti-alpha tubulin (Santa Cruz cat#sc-5286 ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized intraperitoneally with 100 µl of a 1:1 emulsion containing 50 µg recombinant protein LukS or LukF and incomplete Freund’s adjuvant (Sigma-Aldrich, Taufkirchen, Germany). Mice were boosted with an emulsion of protein and incomplete Freund’s adjuvant at day 14 and 28 and bled after six weeks ...
-
bioRxiv - Microbiology 2023Quote: ... active and inactive NS2B(H)-NS3 pro proteases were generated as described previously and cloned into the MCS1 (multiple cloning site 1) of dual protein expression plasmid pETDuet-1 (Novagen, Beijing, China) through restriction sites EcoRI and NotI ...
-
bioRxiv - Physiology 2024Quote: ... For colocalization 1:100 anti-CHRM3 was incubated with 1:500 anti-Clara Cell Secretory Protein (CCSP; Merck Millipore cat#07– 623), 1:200 anti-alpha tubulin (Santa Cruz ...
-
bioRxiv - Molecular Biology 2021Quote: ... elution profiles and sample purity were confirmed by Western blot with antibodies against His tag (Sigma, H1029, lot 033m4785) and Strep tag (IBA ...
-
bioRxiv - Neuroscience 2022Quote: ... A total of 3×106 co-transformants was initially screened for growth on synthetic defined media (SD)-Leu-/ Trp-/ Ura-/ His- media containing 20mM of 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich). Plasmids were isolated from the potential positive colonies ...
-
bioRxiv - Plant Biology 2021Quote: ... The resulting transformants were spotted on SD (−Leu, −Trp) and SD (−Trp, −Leu, −His) selection media containing different concentration of 3-amino-1,2,4-triazole (Sigma, A8056) as previously reported (Putarjunan et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... Adult zebrafish were assayed for response to a mixture of 8 amino acids (Ala, Cys, His, Lys, Met, Phe, Trp, and Val; 0.1 mM each in distilled water; Sigma). No stimulation was provided for the first 5 mins following which the amino acid mix was introduced in one side of the tank at the rate of 1 ml/min using a syringe pump ...
-
bioRxiv - Biochemistry 2021Quote: ... The resulting lysate was clarified by centrifugation and the supernatant was applied to Ni2+ -NTA His-Bind Resin (Novagen). Resin was washed with binding buffer and His wash buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... The culture media for the dividing cells (HI-10) consisted of RPMI-1640 medium + 10% heat inactivated FBS (Sigma), 100 μg/mL penicillin and 100 μg/mL streptomycin ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SIRV2 gp21 and SiL_0190 with C-terminal His-tag were expressed using Escherichia coli RosettaTM (DE3) cells (Novagen). Protein expression was induced during logarithmic growth through the addition of 0.5mM isopropyl-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2023Quote: ... The supernatant was filtered through a 0.22 µm filter then applied to a 5 mL His-TrapTM HP (Sigma) column pre-equilibrated with the same buffer at a flow rate of 1.5 mL.min-1 ...
-
bioRxiv - Microbiology 2023Quote: An N-terminal His-tagged fusion of HcpGA1 was constructed by cloning QR305_02952 into the NdeI–BamHI sites of pET16b (Novagen), and the plasmid was transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was isolated and combined with 2 ml of nickel-nitrilotriacetic acid (Ni-NTA) His Bind resin (Novagen), incubated at room temperature for 20mins and poured into a 1-cm separation column (Bio-Rad) ...