Labshake search
Citations for Millipore Sigma :
1601 - 1650 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: The FLAG-tagged peptide and Pgk1 were detected using the anti-FLAG M2 (Sigma; cat# F1365; 1:1000 dilution) and anti-Pgk1 22C5D8 (abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... Immunoprecipitation of Flag-tagged proteins from cleared lysates was performed with Anti-Flag M2 Affinity Agarose Gel (Sigma-Aldrich) at 4°C for 3 h ...
-
bioRxiv - Biochemistry 2023Quote: ... The FLAG-tagged RIG-I was pulled down using anti-FLAG M2 magnetic beads purchased from Sigma-Aldrich (M8823). The proteins were eluted from beads in 30 μL of 4x Laemmli buffer heated to 95 °C for 5 mins and the entire elution was run on a Western blot using anti-FLAG (Sigma-Aldrich F3165 ...
-
bioRxiv - Cell Biology 2024Quote: ... before clarification by centrifugation and enrichment for FLAG-tagged proteins using anti-FLAG® M2 Affinity Gel (A2220, Sigma), with elution using 3xFLAG peptide (F4799 ...
-
bioRxiv - Microbiology 2024Quote: ... and FLAG-tagged proteins were detected by alkaline-phosphatase-conjugated anti-FLAG IgG (A9469, Sigma Aldrich, St. Louis, MO) and 1-Step NBT/BCIP substrate solution (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Clarified lysate was loaded onto a gravity column containing 1 mL HIS-Select Nickel Affinity Gel (Sigma) pre-equilibrated with Resuspension Buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... pTB146 His-SUMO-mSTING (residues 139-378) was expressed in Rosetta (DE3) pLysS competent cells (Sigma-Aldrich). Cells were grown in 2×YT medium with 100 μg/mL ampicillin until they reached an OD600 of 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... blotted onto nitrocellulose and the proteins were detected with an anti-His antibody (Sigma-Aldrich, Steinheim, Germany). To test whether 6His-PBBem1 and Cdc11 can bind simultaneously to Cdc24428-854 ...
-
bioRxiv - Biochemistry 2019Quote: ... Lysates were then added directly to 96-well His-Select Ni-NTA resin filter plates (Sigma Aldrich) and processed off-robot by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... and the supernatants were independently applied to a column of HIS-Select Nickel Affinity Gel (Sigma-Aldrich) equilibrated with 50 mM sodium phosphate buffer ...
-
bioRxiv - Biophysics 2021Quote: ... followed by cleavage of the His-tag with 3C protease and dephosphorylation with bovine alkaline phosphatase (Sigma). Further purification was performed by ion exchange chromatography (Source Q for WT and the S897E ...
-
bioRxiv - Microbiology 2020Quote: ... The proteins were detected using the primary antibody (Mouse α-His at 1:2500 dilution, Sigma Aldrich) followed by the HRP conjugated secondary antibody (Sheep α-Mouse at 1:7000 dilution ...
-
bioRxiv - Biophysics 2020Quote: ... and passed through pre-equilibrated HIS-Select Ni-nitrilotriacetic acid resin (Ni-NTA) (Sigma-Aldrich Co., USA) at 4 °C for binding of 6x-His tagged protein ...
-
bioRxiv - Cell Biology 2022Quote: ... The following primary antibodies were used: anti-His (1: 2000, Cat No: 70796-4, Novagen, Madison, WI); anti-DNALI1 (1 ...
-
bioRxiv - Cell Biology 2019Quote: ... The His-tag was removed by cleavage with 16 U of thrombin (Ref 27-0846-01, Sigma) added directly onto the beads for 2h at 25°C ...
-
bioRxiv - Biochemistry 2021Quote: ... pneumoniae LicB with an N-terminal 10×His affinity tag in a modified pET-19b vector (Novagen) was overexpressed in E ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... plasmid coding for 6x-His-Cas9 were transformed in Rosetta DE3 Novagen competent cells (Merck Millipore, USA). Protein production was induced using autoinduction medium (Formedium ...
-
bioRxiv - Biophysics 2021Quote: ... The His-eluent was concentrated using a 30 kDa cutoff Amicon Ultra-4 centrifugal filter (Millipore UFC803008), filtered using a 0.22 μm Millex-GP PES membrane (Millipore SLGP033RS) ...
-
bioRxiv - Microbiology 2022Quote: ... with the following modifications: Mouse anti-GST tag or mouse anti-His tag 1:200× (Sigma-Aldrich) and HRP-conjugated goat anti-mouse IgG 1:2,000× (Seracare Life Sciences ...
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Biochemistry 2023Quote: ... After several rounds of washing with His-AC washing buffer (supplemented with 0.1% Tween-20 (Sigma Aldrich), 0.1% NP-40 (Thermo Fischer Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the His-labelled prey proteins were expressed in Escherichia coli BL21 Rosetta (DE3) (Novagen-Millipore, 70954) and incubated in liquid cultures ...
-
bioRxiv - Cancer Biology 2023Quote: ... pTB146 His-SUMO-mSTING (residues 139-378) was expressed in Rosetta (DE3) pLysS competent cells (Sigma-Aldrich). Cells were grown in 2xYT medium with 100 μg/mL ampicillin until they reached an OD600 of 1 ...
-
bioRxiv - Genetics 2023Quote: ... imidazole was removed from the eluted His-SIRT5 using ultra-0.5 centrifugal filter units (UFC501096, Merck Millipore). 500 µl of the recombinant SIRT5 elution fractionation was added to the ultra-0.5 centrifugal filter units and centrifuged at 14,000 x g for 15 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell pellets were resuspended in 2% HI-FBS PBS with 1 µg/mL DAPI (Sigma Aldrich, #D9542) to stain dead cells ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant plasmid DNA was transferred to Escherichia coli strain Rosetta 2(DE3)pLysS (Novagen). At least four colonies for each experiment were sequenced to check for errors in the PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... Peprotech) and recombinant rat IFNγ (reconstituted in pH 8 sodium phosphate [10mM; Sigma-Aldrich] were diluted to the required concentrations (LTα 1μg + IFNγ 75ng per injection ...
-
bioRxiv - Cell Biology 2022Quote: ... Expression of recombinant PRDX6 was induced with 1mM isopropyl β-d-thiogalactopyranoside (IPTG, Sigma). The culture was incubated for 20h at 18°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The recombinant protein was then concentrated using centrifugal filter units (Amicon Ultra-4, Millipore) and dialyzed using Slide-A-Lyzer dialysis cassette into storage buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... HMWHA or BCM− was pre-incubated with 300 IU/mL recombinant HYAL2 (Sigma-Aldrich) for 30 min prior to addition to co-cultures.
-
bioRxiv - Cell Biology 2020Quote: Recombinant protein expression was performed using Eschericia coli strain Rosetta™ 2 (DE3) (Novagen) (Merck Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Digestion was performed overnight at 37 °C using recombinant dimethylated SOLu-trypsin (Sigma-Aldrich) with a trypsin:protein ratio 1:20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 500 U/mL ESGRO recombinant mouse Leukemia Inhibitory Factor (LIF) protein (Sigma, ESG1107) at 37°C with 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: ... Purified recombinant S proteins were concentrated using Amicon filtration devices (EMD Millipore, Billerica, MA), buffer-exchanged into PBS and analyzed by SDS-PAGE and Western blotting ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant protein was purified by affinity chromatography using anti-FLAG affinity resin (Sigma). The purified protein was precipitated by 20% trichloroacetic acid ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant RNase R (30 pmols) or Bovine Serum Albumin (BSA, Sigma-Aldrich, MO, USA) were alone or combined with Csm5 WT or Csm5Δ46 (90 ...
-
bioRxiv - Molecular Biology 2022Quote: We concentrated recombinant EGFP fusion proteins using Amicon Ultra centrifugal filters (10K MWCO, Millipore) to an appropriate protein concentration in 250 mM NaCl salt buffer ...
-
bioRxiv - Microbiology 2024Quote: Recombinant ϕLf-UK PSB15 protein was expressed in B834 (DE3) pLysS cells (EMD Millipore) by transforming pR-PSB15 ...
-
bioRxiv - Immunology 2024Quote: ... aliquots of 106 splenocytes were treated with recombinant mouse IL-2 (Sigma, cat # 11271164001) at 5-20 units/mL and cultured in 48 well plate for 30 minutes at 37C ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 µM AMP (Serva) and active recombinant AMPK (16 ng) (Sigma-Aldrich; 14-840) in a total volume of 30 µl ...
-
bioRxiv - Cancer Biology 2022Quote: ... recombinant SHH (C24II) (50 ng/ml, R and D) and Purmorphamine (1.5 μM, Sigma). Plates were then incubated at 37°C at 5% CO2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... This basal medium was completed with 5ng/ml recombinant mouse LIF (Sigma ref LIF2050), 3µM CHIR99021 (Sigma ref SML1046-5MG ...
-
bioRxiv - Microbiology 2023Quote: ... The recombinant proteins were concentrated using an Amicon Ultra (10K; Millipore, Billerica, MA, USA).
-
bioRxiv - Microbiology 2024Quote: ... A luciferase solution containing recombinant luciferase from Photinus pyralis (Sigma-Aldrich, 20 μg/mL), ATP disodium trihydrate (Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... and histidine but supplemented with 2.5 mM 3-AT (3-Amino-1,2,4-triazole; Sigma) for 4 days at 28°C.
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... washed 3 times in PBS before incubation in PBS supplemented with 3% BSA (Sigma) for 30 min to block non-specific antibody binding ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.12 g (6.25 mmol) of 1-ethyl-3-(3-dimethyllaminopropyl) carbodiimide HCl (Sigma Aldrich) was added to the flask containing 0.98 g (2.7 mmol ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2021Quote: ... histone 3 lysine 27 tri-methylation (H3K27me3) and histone 3 antibodies (all from Millipore). Positive bands were detected by chemiluminescent reagents (Thermofisher ...