Labshake search
Citations for Millipore Sigma :
1551 - 1600 of 2487 citations for 8 Bromoguanosine hydrate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... adjusted to pH = 8 with 2 M NaOH and syringe-filtered (Millex® MP 0.22 μm, Millipore Sigma). Extreme caution was taken to prohibit contamination ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-8 dpf Islet2b:PA-GFP larvae were injected with BODIPY membrane dye (1nL of 1mg/mL; Sigma, D3821) into the space behind the right eye and underlying skin to demarcate retinal anatomy and facilitate subsequent targeting ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Each well of an 8-well chamber μ-slide was coated with 5 μg of fibronectin (F1141, Sigma) overnight at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... purchased from the listed manufacturers: the complex I inhibitors capsaicin (8-methyl-N-vanillyl-6-nonenamide, Sigma-Aldrich), dihydrocapsaicin (N-(4-Hydroxy-3-methoxybenzyl)-8-methylnonanamide ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysates (20-40 μg) were subjected to 8-15% SDS-PAGE and transferred to nitrocellulose membranes (Millipore). The membrane was blocked using 5% milk in TBST buffer at room temperature for 1 h ...
-
bioRxiv - Physiology 2021Quote: ... Proteins were resolved by SDS-PAGE on 8% acrylamide gels and electrotransferred onto Immobilon P (Millipore, Bedford, MA). Then ...
-
bioRxiv - Physiology 2021Quote: ... Glycogen content was measured using the same kit following an 8 h amyloglucosidase (A9228, Sigma-Aldrich Canada Co.) digestion in a dark drawer at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... were transduced with inducible S TEMCCA and rtTA lentivirus-containing supernatants overnight in 8 μg/ml polybrene (Sigma). Doxycycline (2μg/ ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... twice with LiCl wash buffer (10 mM Tris-HCl [pH 8], 250 mM LiCl, 0.5% sodium deoxycholate, 1 mM EDTA, 0.5% IGEPAL CA-630 [Sigma]), and twice with 10 mM Tris-HCl [pH 8] ...
-
bioRxiv - Developmental Biology 2020Quote: ... Zebrafish aged 8-9 months (adult) or 1 month (juvenile) were culled in high dose tricaine (Sigma Aldrich), immersed for 5 min in 1% Virkon (3S Healthcare ...
-
bioRxiv - Cell Biology 2020Quote: Mouse of 5-8 weeks of age were injected intraperitoneally (IP) with 1 µg/g of Tunicamycin (Sigma) using 150 mM of D-Glucose as vehicle ...
-
bioRxiv - Cell Biology 2020Quote: Fixed cells were permeabilized using ice-cold Hi-C lysis buffer (10 mM TRIS-HCl pH 8 [Sigma] ...
-
bioRxiv - Cell Biology 2021Quote: ... filtered (0.45 μm) and used to infect target cells in the presence of 8 μg/mL polybrene (Millipore) at MOI < 1 ...
-
bioRxiv - Immunology 2021Quote: ... Concentrated lentiviral supernatants were used to transduce cells in the presence of 8 μg/ml Polybrene (Sigma-Aldrich), and infected cells were selected by FACS sorting and subjected to imaging experiments.
-
bioRxiv - Microbiology 2022Quote: ... Then 1 mL of lysis buffer (8 M Urea buffer, 50 mM NH4HCO3, phosphatase inhibitors (Sigma-Aldrich, P2745), and protease inhibitors cocktail (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... 900 µL freshly prepared Urea buffer (10 mM HEPES pH 7.4, 1 mM EDTA pH 8.0, 8 M Urea (U4883, Sigma)) was added ...
-
bioRxiv - Microbiology 2022Quote: ... before transduction of TREx BCBL1-Rta cells in the presence of 8 μg/mL of polybrene (Merck Millipore). Virus supernatant was removed 6 hours post transduction and fresh media added ...
-
bioRxiv - Microbiology 2022Quote: ... Coronavirus OC43 (ATCC VR-1558) was propagated in HCT-8 cells and detected by antibody staining (MAB9012, Millipore).
-
bioRxiv - Developmental Biology 2022Quote: ... Single mESC clones were picked 7-8 days after transfection and plated onto 96-well synthemax (Sigma, #CLS3535) coated plates and screened for genomic DNA deletion by PCR using primers outside of the deletion region.
-
bioRxiv - Cell Biology 2022Quote: Adult (week 8) mice (Cx40-ChR2 and DbhCreERT/Rosa26-tdTomato transgenic mouse model) were injected with Tamoxifen (Sigma) (150 mg/kg ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and a titration of trimethoprim (0, 1, 2, 4, 8, 16, 24, and 32 µg/mL) (Sigma Aldrich) with 0.4 % dimethylsulfoxide ...
-
bioRxiv - Microbiology 2023Quote: ... at which point 32.5 μL of a mixture containing an 8:5 ratio of 0.6 mM resazurin (Sigma) dissolved in 1X phosphate-buffered saline to 20% Tween 80 was added ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... specimens (n=8 from each group) were sacrificed using a lethal dose (400ppm) of tricaine (MS-222; Sigma) and immediately imaged under light microscopy at 20x before rigor mortis set in to maintain flexibility in the jaw joints ...
-
bioRxiv - Neuroscience 2023Quote: ... Antibodies were diluted in 1% Tween in PBS or 5% Bovine Serum Albumin (Sigma, CAS # 9048-46-8) prepared in 1% Tween in PBS (filtered ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell pellets were lysed with 8 M urea supplemented with 1x HALT in 200 mM EPPS (E0276 Sigma) by pipetting up and down 10 times ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus containing media was added to ATG3 KO HeLa cells with 8 μg/mL polybrene (Sigma-Aldrich, H9268). After a day ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were seeded in 8 cm2 flasks hanging a microcentrifuge tube containing either 1 ml benzethonium hydroxide (Sigma) (for 14CO2 equilibration ...
-
bioRxiv - Biochemistry 2023Quote: ... and 8% D2O using a Millipore Amicon Ultra-15 Centrifugal Filter Ultracel-3K (Millipore #UFC900324, 3 kDa cutoff), concentrated to a concentration of 50 μM and transferred to an NMR tube after removal of any precipitates by centrifugation ...
-
bioRxiv - Bioengineering 2023Quote: ... whereas the viral particles present in the supernatant were concentrated with 8% PEG8000 (Polyethylene glycol 8000, Sigma-Aldrich) by precipitation (4000g ...
-
bioRxiv - Cell Biology 2023Quote: ... Spastin protein was resolved on 8% SDS-PAGE gels transferred to Immobilon®-FL PVDF membranes (Millipore; 05317) using a wet blot transfer system (BioRad) ...
-
bioRxiv - Neuroscience 2022Quote: ... amplified off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich), using the primers KLB163 (AGACGCGGCCGCCGCGGGAGTACTTTACGGG ...
-
bioRxiv - Neuroscience 2022Quote: ... amplified off of phenol-extracted followed by ethanol precipitated whole-worm gDNA (Phenol pH 8 from Sigma Aldrich), using the KLB161 (AGACGCTAGCGAACTTTTTTCTTCTAATTTTTTGA ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4°C) and resuspended in B cell medium supplemented with 8 μg/mL polybrene (#TR-1003, EMD Millipore) at a density of 2×106 cells/mL ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... These fragments were homogenized by placing them in 2.0 mL screw-cap tubes containing a single 3.0 mm and 8 1.5 mm stainless steel beads and shaking them in a BeadBugmicrotube homogenizer (#Z763713, Sigma) for 120 seconds at a speed setting 3500 rpm ...
-
bioRxiv - Cell Biology 2023Quote: ... Atg3 KO MEFs were treated with the retrovirus containing medium and 8 μg/mL polybrene (Sigma- Aldrich, H9268). After 2 days ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 8) and concentrated to 30 mg/ml using an Amicon Ultra-15 Centricon (Millipore Merck, Darmstadt, Germany). Crystallization experiments were performed with ORYX8 pipetting robot (Douglas Instruments ...
-
bioRxiv - Cancer Biology 2022Quote: Sucrose gradient fractionation was performed by first layering sucrose (8%, 30%, 45%, and 60% w/v; Sigma-Aldrich) in PBS (pH 7.4) ...
-
bioRxiv - Physiology 2023Quote: ... NRVM were treated for 24 h or 8 h with isoproterenol 100µmol/L (Isoprenaline hydrochloride, I5627, Sigma-Aldrich), 6-aminonicotinamide 2.5mmol/L (A68203 ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinas were continuously superfused (∼8 mL/min) with oxygenated (95% O2, 5% CO2) bicarbonate-buffered Ames solution (Sigma) maintained at 25°C–28°C.
-
bioRxiv - Developmental Biology 2024Quote: ... 8-cell and morula stage embryos were obtained by flushing the oviduct with M2 medium (Sigma-Aldrich # M7167) by inserting a fine needle through the infundibulum and collecting the embryos ...
-
bioRxiv - Cell Biology 2024Quote: ... falciparum cultures (4-8 hpi) were treated with apicoplast inhibitors (either 5 µM clindamycin (Sigma-Aldrich, PHR 1159) for > 50 times the delayed death IC₅₀ ...
-
bioRxiv - Molecular Biology 2023Quote: ... Pellets were dissolved in 2X loading buffer (8 M urea with bromophenol blue dye (Sigma-Aldrich, #B0126-25G)) and run on a 10% urea PAGE gel at 16 W for 45 min ...
-
bioRxiv - Bioengineering 2023Quote: ... (in mM as follows: 37 NaCl, 2.7 KCl, 8 Na2HPO4, 1.4 KH2PO4; pH 7.2; all chemicals from Sigma-Aldrich)149 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transduced in RPMI supplemented with 10% FBS and 8 μg/ml protamine sulfate (P4020, Sigma Aldrich). Virus was added at a MOI 5 and a spinoculation step (centrifugation x1000g at 32°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 % (v/v) glycerol) by using a D-Tube Dialyzer with MWCO 6-8 kDa (Millipore, #71507-M) for 16 h at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... mixed with ∼5 x 105 Jiyoye cells in the presence of 8 µg/ml polybrene (Sigma-Aldrich/Merck) and spun at 800 g for 2 h ...
-
bioRxiv - Plant Biology 2023Quote: ... were either stored frozen at –80°C or resuspended in 1 ml of 8 M guanidine HCl (Sigma) in refolding buffer (250 mM NaCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... and resuspended in 9.5 ml GBSS containing 0.3% bovine serum albumin (BSA) and 8 ml 28.7% Histodenz solution (Sigma-Aldrich) to reach an approximate density of 1.070 ...
-
bioRxiv - Biochemistry 2024Quote: ... These cells were transduced with the lentiviral particles using Polybrene (8 μg/ml; Sigma-Aldrich TR-1003-G). Puromycin (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... retroviral particles were directly added to U2OS cells in the presence of polybrene (8 μg/ml, Sigma-Aldrich). Twenty-four hours after infection ...