Labshake search
Citations for Millipore Sigma :
1451 - 1500 of 10000+ citations for SARS CoV 2 Nucleoprotein His tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: TAG quantification was performed using Triglyceride Quantification kit (Sigma-Aldrich). For TAG quantification of whole body ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-HA-Tag (1:500, rabbit Sigma-Aldrich H3663), anti-FLAG (1:50 ...
-
bioRxiv - Microbiology 2024Quote: ... rabbit polyclonal against FLAG tag at 1:500 (F7425, Millipore), rabbit polyclonal against Myc tag at 1:2000 (ab9106 ...
-
bioRxiv - Microbiology 2023Quote: ... An anti-histidine tag antibody (Sigma, St. Louis, MO, USA) and serum from the immunized mice were used as positive controls ...
-
bioRxiv - Microbiology 2023Quote: ... or with rabbit primary antibodies against HA-tag (Sigma-Aldrich) followed by anti-rabbit HRP-conjugated secondary antibodies ...
-
bioRxiv - Plant Biology 2024Quote: ... 100 μL of HA-tag antibody-agarose beads (Sigma-Aldrich) pre-equilibrated in extraction buffer or 5 μL of anti-LUC antibodies (Sigma-Aldrich ...
-
bioRxiv - Genetics 2024Quote: ... The monoclonal anti-S-tag antibody (SAB2702227, Sigma-Aldrich®) was used ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The plasmid that contains the kinase domain of human HASPIN was transformed into Escherichia coli strain Rosetta™ 2(DE3) pLysS (Novagen, Madison, WI, USA). The transformed cells were grown at 37□ until OD600 reached 0.8 ...
-
Evidence for Involvement of WDPCP Gene in Alcohol Consumption, Lipid Metabolism, and Liver CirrhosisbioRxiv - Genetics 2023Quote: ... were incubated together with either 35 µL of PBST (for free glycerol measurements) or 35 µL of TAG reagent (Sigma, no. T2449, for TAG measurements) at 37 °C for 60 min ...
-
bioRxiv - Microbiology 2022Quote: ... hormones were maintained in the culture medium throughout the course of each assay. 17-ß-estradiol (i. e., E2) and progesterone (i. e., P4) (both from Sigma; St. Louis, MO) were selected for use in infection studies because these hormones represent the major forms of estrogens and of progestogens (respectively ...
-
bioRxiv - Physiology 2021Quote: ... The sections were further stained with hematoxylin and eosin (H&E) that was conducted on 10% formalin-fixed muscle section with Mayer’s H&E (Sigma Chemical, St. Louis, MO, USA). Immunofluorescence (IHC ...
-
bioRxiv - Cell Biology 2019Quote: ... Rotenone and Williams E Media from Sigma-Aldrich (Dorset, UK). Ammonium chloride ...
-
bioRxiv - Developmental Biology 2021Quote: ... Oocytes and embryos were incubated in 0.5% pronase E (Sigma) for 3-5 minutes to remove zona pellucida ...
-
bioRxiv - Cancer Biology 2020Quote: ... Sections were stained with hematoxylin and eosin (H&E) (Sigma). Antigen retrieval was performed with citrate buffer pH6 ...
-
bioRxiv - Neuroscience 2021Quote: ... and plated on poly-D-lysine (PDL, A003-E, Millipore) coated 10 cm dishes ...
-
bioRxiv - Plant Biology 2021Quote: ... (1990) with 0.8% (w/v) agar (Type E, Sigma- Aldrich). When required ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg/mL of Pronase E protease mixture (Sigma–Aldrich) was gently added directly and allowed to incubate at 37 °C (2 h) ...
-
bioRxiv - Cell Biology 2022Quote: ... Isolated HFs were maintained in Williams E media (Sigma-Aldrich) supplemented with 2 mM L-glutamine ...
-
bioRxiv - Microbiology 2020Quote: ... Parasites were sedimented on poly-lysine (A-003-E, SIGMA) coverslips (150µL/coverslip ...
-
bioRxiv - Cancer Biology 2022Quote: ... and stained with haematoxylin and eosin (H&E; Merck + Sigma) or IHC using antibodies of interest ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated with mouse anti-E-cadherin (Millipore, MAB1199) at 1:200 dilution in blocking solution at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... transferred to the Immobilon-P/E PVDF membrane (Merck Millipore), and immunodetected using the SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: ... followed by additional infiltration with 20 μM E-64d (Sigma) for an 8 h period ...
-
bioRxiv - Neuroscience 2020Quote: ... Pronase E (Protease from Streptomyces griseus Type XIV, Sigma Aldrich) was diluted in water to a concentration of 2 mg/mL ...
-
bioRxiv - Neuroscience 2020Quote: E-4031 (Alomone-Labs, IL) and TEA (Sigma-Aldrich, USA) were dissolved in 0.9% saline ...
-
bioRxiv - Immunology 2020Quote: ... E-64 and 3-Methyladenine (3-MA) were from Sigma. Necrostatin-1 was from Abcam ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were stained with hematoxylin and eosin (H&E, Sigma) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred to Immobilon-E PVDF Transfer membrane (Sigma, IEVH85R). Blocked the membrane with 5% skimmed milk and incubated with primary antibody i.e. ...
-
bioRxiv - Molecular Biology 2022Quote: ... sectioned (3 μm sections) and stained with H&E (Sigma). LLC tumor samples and dorsal skin were embedded in 3.5- 4 % agar ...
-
bioRxiv - Pathology 2024Quote: ... a 1% aqueous solution of eosin Y (Sigma E-6003) was prepared in deionized water and Harris Hematoxylin stain (Lerner Laboratories 1931382 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Barium – gelatin mix (E-Z-EM Canada Inc; Sigma-Aldrich) was perfused until consistent pressure matching RVSP was obtained ...
-
bioRxiv - Cancer Biology 2024Quote: ... and E-cad shRNA (TRCN0000237841, target sequence; AGATTGCACCGGTCGACAAAG, Millipore Sigma). Lentiviral supernatant was prepared by co-transfecting HEK-293T cells with lentivirus packaging plasmids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... D-Asp3-E-Dhb7-RR was purchased from Sigma Aldrich. Anabaenopeptin A and B ...
-
bioRxiv - Bioengineering 2024Quote: Channel blockers E-4031 and nifedipine were purchased from Sigma, aliquoted in DMSO at a concentration of 10 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... Rabbit polyclonal anti-α E-catenin (C2081) was from Sigma. Rabbit polyclonal anti-phospho-Myosin Light Chain 2 (Thr18/Ser19 ...
-
bioRxiv - Neuroscience 2023Quote: ... hNPCs were treated with 100 nM compound E (EMD Millipore) in Neural Medium for 48 hours and then maintained in Neural Medium supplemented with 20 ng/ml each of hBDNF and hGDNF for 3 weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... Following resuspension in 50 ml/tube of E-MEM (Sigma), large cell aggregates were eliminated by filtering the cell suspension with a 60-μm stainless cell strainer (Ikemoto Scientific Technology) ...
-
bioRxiv - Biochemistry 2023Quote: ... William’s E Medium and hydrocortisone were purchased from Sigma Aldrich. Human insulin was purchased from pharmacy (Humulin N ...
-
bioRxiv - Cell Biology 2023Quote: ... and rat anti-human E-cadherin (EMD Millipore, DECMA-1) at a concentration of 1/200 in a humidified incubator overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... apolipoprotein E (ApoE, raised in goat, 1:500, 178479, Millipore).
-
bioRxiv - Microbiology 2024Quote: ... and sections stained with H&E (Sigma-Aldrich, Darmstadt, Germany). Slides were scanned using Aperio AT Turbo (Aperio ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ng/ ml epidermal growth factor (Sigma-Aldrich, e-4127), 0.5 µg/ ml hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2019Quote: ... The cell lysate was combined with His-Select Co2+ resin (Sigma) for 1 hour at 4 °C ...
-
bioRxiv - Biophysics 2021Quote: ... anti-6×His and anti-FLAG M2 (Sigma-Aldrich, Merck, USA). The anti-mouse IgG ...
-
bioRxiv - Biochemistry 2021Quote: ... Clarified lysate was applied to Ni-NTA His-Bind Resin (Novagen). Resin was washed with binding buffer and then eluted in batches with buffer containing increasing amounts of imidazole (up to 800 mM) ...
-
bioRxiv - Biochemistry 2021Quote: ... Clarified lysate was applied to Ni-NTA His-Bind Resin (Novagen). Resin was washed with binding buffer and then eluted in batches with buffer containing increasing amounts of imidazole (up to 300 mM) ...
-
bioRxiv - Microbiology 2021Quote: ... and a combination of α-6×His antibody (Sigma Aldrich, H1029) and HisProbe-HRP (Thermo ...
-
bioRxiv - Biophysics 2021Quote: ... the proteins were purified using His-Select Nickel agarose resin (Sigma) and anion exchange chromatography (Source Q ...
-
bioRxiv - Plant Biology 2022Quote: PIF3 recombinant proteins were prepared using PIF3-his DNA (pET28C, Novagen) provided by Ferenc Nagy and induced and purified using commercial kit (Amersham) ...
-
bioRxiv - Cell Biology 2021Quote: His-ACBD5 was expressed in BL21 Rosetta (DE3) cells (EMD Millipore) induced with 1 mM IPTG overnight at 18°C ...